Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632328_at:

>probe:Drosophila_2:1632328_at:265:261; Interrogation_Position=1971; Antisense; CACGCACCATCAGCGAGGTCAAGAA
>probe:Drosophila_2:1632328_at:149:645; Interrogation_Position=1989; Antisense; TCAAGAACTTTGAGCCCTGGAGGGA
>probe:Drosophila_2:1632328_at:424:129; Interrogation_Position=2057; Antisense; ACCTGCAAGCTGACCTCCAAGGAGG
>probe:Drosophila_2:1632328_at:651:527; Interrogation_Position=2088; Antisense; GGGAGACCATCAACCTGCAGACCTG
>probe:Drosophila_2:1632328_at:13:185; Interrogation_Position=2126; Antisense; AACAACTACCCATGGGTCAGCGATC
>probe:Drosophila_2:1632328_at:90:495; Interrogation_Position=2141; Antisense; GTCAGCGATCCCACTGGCGATGGTT
>probe:Drosophila_2:1632328_at:529:573; Interrogation_Position=2156; Antisense; GGCGATGGTTTCTTCTAAGTCAGCG
>probe:Drosophila_2:1632328_at:638:657; Interrogation_Position=2171; Antisense; TAAGTCAGCGATCTTAGCCCCATGC
>probe:Drosophila_2:1632328_at:354:675; Interrogation_Position=2274; Antisense; TAGCCCAACACAAACTCGATCGATT
>probe:Drosophila_2:1632328_at:698:193; Interrogation_Position=2286; Antisense; AACTCGATCGATTATCGCCCATTTG
>probe:Drosophila_2:1632328_at:147:353; Interrogation_Position=2338; Antisense; GCACTCGTACTCTCTATTTGACTGA
>probe:Drosophila_2:1632328_at:265:251; Interrogation_Position=2373; Antisense; CAAGTCTTTGCTGTGTTACGGTTAT
>probe:Drosophila_2:1632328_at:586:181; Interrogation_Position=2451; Antisense; AAAACTGCAAGCCACAACATCCGAA
>probe:Drosophila_2:1632328_at:329:149; Interrogation_Position=2467; Antisense; ACATCCGAACTTGTGTTTACACTCT

Paste this into a BLAST search page for me
CACGCACCATCAGCGAGGTCAAGAATCAAGAACTTTGAGCCCTGGAGGGAACCTGCAAGCTGACCTCCAAGGAGGGGGAGACCATCAACCTGCAGACCTGAACAACTACCCATGGGTCAGCGATCGTCAGCGATCCCACTGGCGATGGTTGGCGATGGTTTCTTCTAAGTCAGCGTAAGTCAGCGATCTTAGCCCCATGCTAGCCCAACACAAACTCGATCGATTAACTCGATCGATTATCGCCCATTTGGCACTCGTACTCTCTATTTGACTGACAAGTCTTTGCTGTGTTACGGTTATAAAACTGCAAGCCACAACATCCGAAACATCCGAACTTGTGTTTACACTCT

Full Affymetrix probeset data:

Annotations for 1632328_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime