Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632330_at:

>probe:Drosophila_2:1632330_at:248:67; Interrogation_Position=125; Antisense; ATGGACGATCGTTTTTCTTTCTGGG
>probe:Drosophila_2:1632330_at:390:725; Interrogation_Position=154; Antisense; TTGTTTCGTCGTTGGCGTAACCGCT
>probe:Drosophila_2:1632330_at:260:493; Interrogation_Position=170; Antisense; GTAACCGCTGGATGGCCTCTCACAA
>probe:Drosophila_2:1632330_at:339:303; Interrogation_Position=218; Antisense; CCGCCTATCCCATATCTGGTTATTA
>probe:Drosophila_2:1632330_at:593:5; Interrogation_Position=245; Antisense; ATTGTCCTGTATATGGCTGCAGCCT
>probe:Drosophila_2:1632330_at:38:3; Interrogation_Position=277; Antisense; ATTGGTCCTCAACCAGGTTACTACG
>probe:Drosophila_2:1632330_at:160:709; Interrogation_Position=294; Antisense; TTACTACGCTACACCTGCAGGATTT
>probe:Drosophila_2:1632330_at:161:75; Interrogation_Position=312; Antisense; AGGATTTTACACCATGCCTCTGAAT
>probe:Drosophila_2:1632330_at:152:85; Interrogation_Position=379; Antisense; AGTGATCAAAATTCCGCGACGTCTG
>probe:Drosophila_2:1632330_at:246:409; Interrogation_Position=396; Antisense; GACGTCTGGAAGTCCCATGGGCTAT
>probe:Drosophila_2:1632330_at:645:483; Interrogation_Position=423; Antisense; GTATCTGAGCGGAGCTTCGCCGATA
>probe:Drosophila_2:1632330_at:326:153; Interrogation_Position=513; Antisense; ACAGGCCAGCGCAGGTGGGTATTCT
>probe:Drosophila_2:1632330_at:9:665; Interrogation_Position=581; Antisense; TACCCTTCCAATACCCTGGGATGAA
>probe:Drosophila_2:1632330_at:1:57; Interrogation_Position=59; Antisense; ATGGATCTCAGAAAACCGACTTGGA

Paste this into a BLAST search page for me
ATGGACGATCGTTTTTCTTTCTGGGTTGTTTCGTCGTTGGCGTAACCGCTGTAACCGCTGGATGGCCTCTCACAACCGCCTATCCCATATCTGGTTATTAATTGTCCTGTATATGGCTGCAGCCTATTGGTCCTCAACCAGGTTACTACGTTACTACGCTACACCTGCAGGATTTAGGATTTTACACCATGCCTCTGAATAGTGATCAAAATTCCGCGACGTCTGGACGTCTGGAAGTCCCATGGGCTATGTATCTGAGCGGAGCTTCGCCGATAACAGGCCAGCGCAGGTGGGTATTCTTACCCTTCCAATACCCTGGGATGAAATGGATCTCAGAAAACCGACTTGGA

Full Affymetrix probeset data:

Annotations for 1632330_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime