FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632331_at:

>probe:Drosophila_2:1632331_at:341:245; Interrogation_Position=2723; Antisense; AATTTATCTGAAGCGCTGGCACATC
>probe:Drosophila_2:1632331_at:188:585; Interrogation_Position=2739; Antisense; TGGCACATCCACTACTATTACTCTT
>probe:Drosophila_2:1632331_at:655:21; Interrogation_Position=2826; Antisense; ATATCCCAGAGAGATCCCAGTGCCG
>probe:Drosophila_2:1632331_at:228:87; Interrogation_Position=2844; Antisense; AGTGCCGTCTACGATATCTTCATCA
>probe:Drosophila_2:1632331_at:175:369; Interrogation_Position=2879; Antisense; GAATGATCGGACCTGGGTGCTCAAT
>probe:Drosophila_2:1632331_at:71:509; Interrogation_Position=2895; Antisense; GTGCTCAATGAACTGCTGCCGAACG
>probe:Drosophila_2:1632331_at:24:547; Interrogation_Position=2933; Antisense; GGATGTGTCCATTTGTCTGCATGAA
>probe:Drosophila_2:1632331_at:526:455; Interrogation_Position=2988; Antisense; GATAACATCATCTCCTGCATGGATC
>probe:Drosophila_2:1632331_at:654:281; Interrogation_Position=3014; Antisense; CTCGTATTCCCTTATGCTGATCATA
>probe:Drosophila_2:1632331_at:110:605; Interrogation_Position=3031; Antisense; TGATCATATCCTCCAAGTTCCTGTT
>probe:Drosophila_2:1632331_at:590:93; Interrogation_Position=3046; Antisense; AGTTCCTGTTGAGTCATTGGTGTCA
>probe:Drosophila_2:1632331_at:576:257; Interrogation_Position=3088; Antisense; CACAGCATCGCATCTTTGAGGTCAG
>probe:Drosophila_2:1632331_at:96:421; Interrogation_Position=3117; Antisense; GAGCACTTGATCCTGGTTTTTCTGG
>probe:Drosophila_2:1632331_at:107:437; Interrogation_Position=3141; Antisense; GAGGACATTCCACGGCGAAAGCGAC

Paste this into a BLAST search page for me
AATTTATCTGAAGCGCTGGCACATCTGGCACATCCACTACTATTACTCTTATATCCCAGAGAGATCCCAGTGCCGAGTGCCGTCTACGATATCTTCATCAGAATGATCGGACCTGGGTGCTCAATGTGCTCAATGAACTGCTGCCGAACGGGATGTGTCCATTTGTCTGCATGAAGATAACATCATCTCCTGCATGGATCCTCGTATTCCCTTATGCTGATCATATGATCATATCCTCCAAGTTCCTGTTAGTTCCTGTTGAGTCATTGGTGTCACACAGCATCGCATCTTTGAGGTCAGGAGCACTTGATCCTGGTTTTTCTGGGAGGACATTCCACGGCGAAAGCGAC

Full Affymetrix probeset data:

Annotations for 1632331_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720