Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632332_at:

>probe:Drosophila_2:1632332_at:80:347; Interrogation_Position=1018; Antisense; GCATCAACATATACACACATTCGCA
>probe:Drosophila_2:1632332_at:130:709; Interrogation_Position=1061; Antisense; TTAATCGGACCGAAAGGCCAGCGAG
>probe:Drosophila_2:1632332_at:637:577; Interrogation_Position=1076; Antisense; GGCCAGCGAGAATTGATTGTTTTGT
>probe:Drosophila_2:1632332_at:721:151; Interrogation_Position=1126; Antisense; ACATCATGTTTGTAGTAGTTGCCAA
>probe:Drosophila_2:1632332_at:680:485; Interrogation_Position=1140; Antisense; GTAGTTGCCAACAATTCGATTGTCT
>probe:Drosophila_2:1632332_at:568:345; Interrogation_Position=1241; Antisense; GCATACGCATAACTTTTTCTATACA
>probe:Drosophila_2:1632332_at:324:673; Interrogation_Position=1271; Antisense; TACCGATTTCAAACAGCGCCAAATG
>probe:Drosophila_2:1632332_at:703:269; Interrogation_Position=834; Antisense; CATGCGACTTAGTCACGGGTGTGCT
>probe:Drosophila_2:1632332_at:55:517; Interrogation_Position=852; Antisense; GTGTGCTGGTAGATGTGCCTCCGCT
>probe:Drosophila_2:1632332_at:246:299; Interrogation_Position=873; Antisense; CGCTGCAGCCACATACTGTATGCTA
>probe:Drosophila_2:1632332_at:294:639; Interrogation_Position=900; Antisense; TTAGCCGTTAATGATTAGCCAAGGC
>probe:Drosophila_2:1632332_at:679:673; Interrogation_Position=915; Antisense; TAGCCAAGGCAGTGTACGGCCAGTT
>probe:Drosophila_2:1632332_at:210:579; Interrogation_Position=932; Antisense; GGCCAGTTAGTTAGTATTTATGCAA
>probe:Drosophila_2:1632332_at:469:673; Interrogation_Position=986; Antisense; TACCGAAACTGCATTTTGAGCCGAA

Paste this into a BLAST search page for me
GCATCAACATATACACACATTCGCATTAATCGGACCGAAAGGCCAGCGAGGGCCAGCGAGAATTGATTGTTTTGTACATCATGTTTGTAGTAGTTGCCAAGTAGTTGCCAACAATTCGATTGTCTGCATACGCATAACTTTTTCTATACATACCGATTTCAAACAGCGCCAAATGCATGCGACTTAGTCACGGGTGTGCTGTGTGCTGGTAGATGTGCCTCCGCTCGCTGCAGCCACATACTGTATGCTATTAGCCGTTAATGATTAGCCAAGGCTAGCCAAGGCAGTGTACGGCCAGTTGGCCAGTTAGTTAGTATTTATGCAATACCGAAACTGCATTTTGAGCCGAA

Full Affymetrix probeset data:

Annotations for 1632332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime