FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632335_at:

>probe:Drosophila_2:1632335_at:677:651; Interrogation_Position=296; Antisense; TCAAGCCCTTCCTGAAGAGCCTGAA
>probe:Drosophila_2:1632335_at:11:417; Interrogation_Position=312; Antisense; GAGCCTGAACTACAATCATCTGATG
>probe:Drosophila_2:1632335_at:224:141; Interrogation_Position=349; Antisense; ACGGCGCACGACATCAGCTTTGAGA
>probe:Drosophila_2:1632335_at:645:411; Interrogation_Position=388; Antisense; GACCTGAAGGATCCCGTAAAGCGCA
>probe:Drosophila_2:1632335_at:269:495; Interrogation_Position=436; Antisense; GTCAAGTTCGAGTCCGTCTACAAGG
>probe:Drosophila_2:1632335_at:613:251; Interrogation_Position=471; Antisense; CAAGTGGTTCTTCCAGAAGCTGCGT
>probe:Drosophila_2:1632335_at:590:377; Interrogation_Position=486; Antisense; GAAGCTGCGTTTCTAAGCTGCCCAT
>probe:Drosophila_2:1632335_at:499:261; Interrogation_Position=508; Antisense; CATTCGCTACTTGTGGTTACTGGAT
>probe:Drosophila_2:1632335_at:658:669; Interrogation_Position=525; Antisense; TACTGGATTTGTCGCTCTTTTTTAA
>probe:Drosophila_2:1632335_at:470:195; Interrogation_Position=581; Antisense; AACTGACCGAAGTGGATCCTGTGCC
>probe:Drosophila_2:1632335_at:669:447; Interrogation_Position=595; Antisense; GATCCTGTGCCTTCTTATTAAGTGT
>probe:Drosophila_2:1632335_at:508:517; Interrogation_Position=624; Antisense; GTGGGACAAACGTGCCTATGGTGAT
>probe:Drosophila_2:1632335_at:403:23; Interrogation_Position=734; Antisense; ATATCAAATTCGCTTCTGGATCATT
>probe:Drosophila_2:1632335_at:196:85; Interrogation_Position=768; Antisense; AGTGCAAATTCCATAGCCTTAACCG

Paste this into a BLAST search page for me
TCAAGCCCTTCCTGAAGAGCCTGAAGAGCCTGAACTACAATCATCTGATGACGGCGCACGACATCAGCTTTGAGAGACCTGAAGGATCCCGTAAAGCGCAGTCAAGTTCGAGTCCGTCTACAAGGCAAGTGGTTCTTCCAGAAGCTGCGTGAAGCTGCGTTTCTAAGCTGCCCATCATTCGCTACTTGTGGTTACTGGATTACTGGATTTGTCGCTCTTTTTTAAAACTGACCGAAGTGGATCCTGTGCCGATCCTGTGCCTTCTTATTAAGTGTGTGGGACAAACGTGCCTATGGTGATATATCAAATTCGCTTCTGGATCATTAGTGCAAATTCCATAGCCTTAACCG

Full Affymetrix probeset data:

Annotations for 1632335_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720