FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632336_at:

>probe:Drosophila_2:1632336_at:94:101; Interrogation_Position=107; Antisense; AGAGGAGACGGACCACCTGCTCGAT
>probe:Drosophila_2:1632336_at:638:335; Interrogation_Position=125; Antisense; GCTCGATCAGATCACCAATGGTCTT
>probe:Drosophila_2:1632336_at:402:687; Interrogation_Position=157; Antisense; TATTTGGACTTCTGCGACGAACGCT
>probe:Drosophila_2:1632336_at:704:329; Interrogation_Position=205; Antisense; GCGTGGGTGAGCTATCCCGGAAATA
>probe:Drosophila_2:1632336_at:26:373; Interrogation_Position=245; Antisense; GAAGGGCACTTTTCGTATCATTCGA
>probe:Drosophila_2:1632336_at:44:191; Interrogation_Position=270; Antisense; AACATACCCAACTATTCGGAGGAAT
>probe:Drosophila_2:1632336_at:720:505; Interrogation_Position=304; Antisense; GTGCCAAGGTCACCTGTCTGGATTT
>probe:Drosophila_2:1632336_at:514:167; Interrogation_Position=335; Antisense; AAAGGCCAAGGAATTGCGTCACAAA
>probe:Drosophila_2:1632336_at:511:15; Interrogation_Position=405; Antisense; ATTATTGATTCACCAGATTCTGCAG
>probe:Drosophila_2:1632336_at:483:615; Interrogation_Position=425; Antisense; TGCAGCTGGCGATGGATCTTTCGAG
>probe:Drosophila_2:1632336_at:111:295; Interrogation_Position=446; Antisense; CGAGGATTTAGTCCCATTTGAGAAA
>probe:Drosophila_2:1632336_at:394:649; Interrogation_Position=558; Antisense; TCAGCCTTACTCTCTACAAAATCTT
>probe:Drosophila_2:1632336_at:724:307; Interrogation_Position=606; Antisense; CCATGTATCATGTTAGAATCCCCAA
>probe:Drosophila_2:1632336_at:690:367; Interrogation_Position=621; Antisense; GAATCCCCAATACTCTGCAATAGGC

Paste this into a BLAST search page for me
AGAGGAGACGGACCACCTGCTCGATGCTCGATCAGATCACCAATGGTCTTTATTTGGACTTCTGCGACGAACGCTGCGTGGGTGAGCTATCCCGGAAATAGAAGGGCACTTTTCGTATCATTCGAAACATACCCAACTATTCGGAGGAATGTGCCAAGGTCACCTGTCTGGATTTAAAGGCCAAGGAATTGCGTCACAAAATTATTGATTCACCAGATTCTGCAGTGCAGCTGGCGATGGATCTTTCGAGCGAGGATTTAGTCCCATTTGAGAAATCAGCCTTACTCTCTACAAAATCTTCCATGTATCATGTTAGAATCCCCAAGAATCCCCAATACTCTGCAATAGGC

Full Affymetrix probeset data:

Annotations for 1632336_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720