FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632337_at:

>probe:Drosophila_2:1632337_at:134:717; Interrogation_Position=6188; Antisense; TTCCACTCGGTTTGGACACGGTGAT
>probe:Drosophila_2:1632337_at:203:425; Interrogation_Position=6221; Antisense; GAGGGCTAAACCTGAGTGCCGGCCA
>probe:Drosophila_2:1632337_at:242:271; Interrogation_Position=6244; Antisense; CATCGACAGTTGTTGTGCCTGGCAC
>probe:Drosophila_2:1632337_at:115:449; Interrogation_Position=6284; Antisense; GATCCGTGTGTCTCGTCCTGGACGA
>probe:Drosophila_2:1632337_at:563:85; Interrogation_Position=6340; Antisense; AGTGCACTGCTCAAGGCGGCGGATC
>probe:Drosophila_2:1632337_at:278:9; Interrogation_Position=6394; Antisense; ATTGCCCATCGTCTGACAACTATTC
>probe:Drosophila_2:1632337_at:520:147; Interrogation_Position=6412; Antisense; ACTATTCTGGATTATGACCGCTTAA
>probe:Drosophila_2:1632337_at:292:411; Interrogation_Position=6427; Antisense; GACCGCTTAATTGTGCTGGACCAAG
>probe:Drosophila_2:1632337_at:569:433; Interrogation_Position=6496; Antisense; GAGGGCTCTGTATTCCGTGGTTTAC
>probe:Drosophila_2:1632337_at:441:523; Interrogation_Position=6528; Antisense; GGGCGCCAGCAAATGGTAGATCCTA
>probe:Drosophila_2:1632337_at:236:97; Interrogation_Position=6545; Antisense; AGATCCTAGCTAATTGTGTCATACA
>probe:Drosophila_2:1632337_at:225:497; Interrogation_Position=6562; Antisense; GTCATACAGGCGTTCTTAAGTGCAT
>probe:Drosophila_2:1632337_at:435:347; Interrogation_Position=6583; Antisense; GCATGTGTAGTGCACTTTTCCTAAA
>probe:Drosophila_2:1632337_at:434:601; Interrogation_Position=6646; Antisense; TGTATTTGCGAAAGCCTCTATCCAC

Paste this into a BLAST search page for me
TTCCACTCGGTTTGGACACGGTGATGAGGGCTAAACCTGAGTGCCGGCCACATCGACAGTTGTTGTGCCTGGCACGATCCGTGTGTCTCGTCCTGGACGAAGTGCACTGCTCAAGGCGGCGGATCATTGCCCATCGTCTGACAACTATTCACTATTCTGGATTATGACCGCTTAAGACCGCTTAATTGTGCTGGACCAAGGAGGGCTCTGTATTCCGTGGTTTACGGGCGCCAGCAAATGGTAGATCCTAAGATCCTAGCTAATTGTGTCATACAGTCATACAGGCGTTCTTAAGTGCATGCATGTGTAGTGCACTTTTCCTAAATGTATTTGCGAAAGCCTCTATCCAC

Full Affymetrix probeset data:

Annotations for 1632337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720