FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632341_at:

>probe:Drosophila_2:1632341_at:677:329; Interrogation_Position=112; Antisense; GCGGAGAATACCTCATCACTCATGA
>probe:Drosophila_2:1632341_at:423:649; Interrogation_Position=127; Antisense; TCACTCATGATCTGTCCAATGTGCC
>probe:Drosophila_2:1632341_at:131:311; Interrogation_Position=142; Antisense; CCAATGTGCCATGACGAGATCGAGA
>probe:Drosophila_2:1632341_at:158:637; Interrogation_Position=161; Antisense; TCGAGACGACCACAAAGATCCGGCG
>probe:Drosophila_2:1632341_at:248:523; Interrogation_Position=202; Antisense; GTGGCCTCGGGCATAGTCTTGTTCA
>probe:Drosophila_2:1632341_at:703:25; Interrogation_Position=214; Antisense; ATAGTCTTGTTCACCACCTGCGGCA
>probe:Drosophila_2:1632341_at:521:129; Interrogation_Position=229; Antisense; ACCTGCGGCATTGGATGCTGGCTAA
>probe:Drosophila_2:1632341_at:154:407; Interrogation_Position=268; Antisense; GACTGTTTCAACGAGATCCATCACT
>probe:Drosophila_2:1632341_at:483:499; Interrogation_Position=301; Antisense; GTCTGCAAGGCGACCCTGGGAATCG
>probe:Drosophila_2:1632341_at:255:287; Interrogation_Position=316; Antisense; CTGGGAATCGTTCCGCAGCAGGATC
>probe:Drosophila_2:1632341_at:436:349; Interrogation_Position=333; Antisense; GCAGGATCAGAGGTGGCCAACCTAA
>probe:Drosophila_2:1632341_at:51:65; Interrogation_Position=67; Antisense; ATGGGCTGGGAAACACGGAGATCAC
>probe:Drosophila_2:1632341_at:199:551; Interrogation_Position=83; Antisense; GGAGATCACACAGCACCACGTGGCT
>probe:Drosophila_2:1632341_at:91:129; Interrogation_Position=97; Antisense; ACCACGTGGCTGCTCGCGGAGAATA

Paste this into a BLAST search page for me
GCGGAGAATACCTCATCACTCATGATCACTCATGATCTGTCCAATGTGCCCCAATGTGCCATGACGAGATCGAGATCGAGACGACCACAAAGATCCGGCGGTGGCCTCGGGCATAGTCTTGTTCAATAGTCTTGTTCACCACCTGCGGCAACCTGCGGCATTGGATGCTGGCTAAGACTGTTTCAACGAGATCCATCACTGTCTGCAAGGCGACCCTGGGAATCGCTGGGAATCGTTCCGCAGCAGGATCGCAGGATCAGAGGTGGCCAACCTAAATGGGCTGGGAAACACGGAGATCACGGAGATCACACAGCACCACGTGGCTACCACGTGGCTGCTCGCGGAGAATA

Full Affymetrix probeset data:

Annotations for 1632341_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720