FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632343_at:

>probe:Drosophila_2:1632343_at:209:71; Interrogation_Position=1344; Antisense; AGGCCGTCAATATCCTGGCATCGGA
>probe:Drosophila_2:1632343_at:412:195; Interrogation_Position=1398; Antisense; AACGGAACGTCTCCTACCTGAAGAG
>probe:Drosophila_2:1632343_at:322:611; Interrogation_Position=1428; Antisense; TGAAGCGAGAAGGTTTCCCCGTCGA
>probe:Drosophila_2:1632343_at:249:127; Interrogation_Position=1463; Antisense; AGCCACATCATTCCCATTAAGATCG
>probe:Drosophila_2:1632343_at:362:97; Interrogation_Position=1482; Antisense; AGATCGGAGACCCTCTGAAGAGCAG
>probe:Drosophila_2:1632343_at:427:381; Interrogation_Position=1529; Antisense; GAACAATTCGGACACTACCTGCAGT
>probe:Drosophila_2:1632343_at:144:617; Interrogation_Position=1548; Antisense; TGCAGTCGATTAACTACCCAACCGT
>probe:Drosophila_2:1632343_at:559:57; Interrogation_Position=1628; Antisense; ATGATGAACGCCCTGGTTACCGATC
>probe:Drosophila_2:1632343_at:573:155; Interrogation_Position=1668; Antisense; AAATGGTGGACCTCTCTACAAACGT
>probe:Drosophila_2:1632343_at:475:617; Interrogation_Position=1712; Antisense; TGCATGTTCTGCAACTCGGAGAGCT
>probe:Drosophila_2:1632343_at:425:641; Interrogation_Position=1762; Antisense; TCTGGAGTGTGGCATTCCCAACTGC
>probe:Drosophila_2:1632343_at:486:97; Interrogation_Position=1797; Antisense; AGATCTCGCTTGCAGCATAGTTGCC
>probe:Drosophila_2:1632343_at:150:95; Interrogation_Position=1815; Antisense; AGTTGCCTCTTGGAAACACGACTAT
>probe:Drosophila_2:1632343_at:484:341; Interrogation_Position=1863; Antisense; GCTATGCCTAAATTATCTGTGCGGT

Paste this into a BLAST search page for me
AGGCCGTCAATATCCTGGCATCGGAAACGGAACGTCTCCTACCTGAAGAGTGAAGCGAGAAGGTTTCCCCGTCGAAGCCACATCATTCCCATTAAGATCGAGATCGGAGACCCTCTGAAGAGCAGGAACAATTCGGACACTACCTGCAGTTGCAGTCGATTAACTACCCAACCGTATGATGAACGCCCTGGTTACCGATCAAATGGTGGACCTCTCTACAAACGTTGCATGTTCTGCAACTCGGAGAGCTTCTGGAGTGTGGCATTCCCAACTGCAGATCTCGCTTGCAGCATAGTTGCCAGTTGCCTCTTGGAAACACGACTATGCTATGCCTAAATTATCTGTGCGGT

Full Affymetrix probeset data:

Annotations for 1632343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720