FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632345_at:

>probe:Drosophila_2:1632345_at:231:79; Interrogation_Position=172; Antisense; AGGTTGTGACCTTCGGCAGTCTGGA
>probe:Drosophila_2:1632345_at:94:613; Interrogation_Position=217; Antisense; TGACAGCTGCTTTTCAAGTGCGCCA
>probe:Drosophila_2:1632345_at:24:263; Interrogation_Position=240; Antisense; CAGCGGGCATACGTTCCATATAGTG
>probe:Drosophila_2:1632345_at:724:391; Interrogation_Position=304; Antisense; GAAAGATCTTCACTGGCTGCAATGT
>probe:Drosophila_2:1632345_at:232:615; Interrogation_Position=321; Antisense; TGCAATGTGGAAAACGCCGCCTTTA
>probe:Drosophila_2:1632345_at:444:349; Interrogation_Position=414; Antisense; GCAGGTGCTGTTTTGGCCTACGAAC
>probe:Drosophila_2:1632345_at:159:381; Interrogation_Position=435; Antisense; GAACCTAATGTATTCACCACTCCTT
>probe:Drosophila_2:1632345_at:229:621; Interrogation_Position=459; Antisense; TGCGGCGTTTGTCGTCAGTTTATAC
>probe:Drosophila_2:1632345_at:541:721; Interrogation_Position=490; Antisense; TTGCCAACGCGGATATACCCATATA
>probe:Drosophila_2:1632345_at:93:673; Interrogation_Position=505; Antisense; TACCCATATATGTGGCCCAGGCGAT
>probe:Drosophila_2:1632345_at:585:147; Interrogation_Position=557; Antisense; ACTTTTGCAGAGTGACGATCCCGTC
>probe:Drosophila_2:1632345_at:680:495; Interrogation_Position=579; Antisense; GTCATGTGCACCTCAATCTTTAATC
>probe:Drosophila_2:1632345_at:614:469; Interrogation_Position=605; Antisense; GTTGCCGAGCAGTTTTCACACCTAT
>probe:Drosophila_2:1632345_at:395:393; Interrogation_Position=631; Antisense; GAAAGTAACGACCACTGCAGGCAAG

Paste this into a BLAST search page for me
AGGTTGTGACCTTCGGCAGTCTGGATGACAGCTGCTTTTCAAGTGCGCCACAGCGGGCATACGTTCCATATAGTGGAAAGATCTTCACTGGCTGCAATGTTGCAATGTGGAAAACGCCGCCTTTAGCAGGTGCTGTTTTGGCCTACGAACGAACCTAATGTATTCACCACTCCTTTGCGGCGTTTGTCGTCAGTTTATACTTGCCAACGCGGATATACCCATATATACCCATATATGTGGCCCAGGCGATACTTTTGCAGAGTGACGATCCCGTCGTCATGTGCACCTCAATCTTTAATCGTTGCCGAGCAGTTTTCACACCTATGAAAGTAACGACCACTGCAGGCAAG

Full Affymetrix probeset data:

Annotations for 1632345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720