Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632346_at:

>probe:Drosophila_2:1632346_at:454:443; Interrogation_Position=1636; Antisense; GATGAACTTCCGGAGCGCATTAGCA
>probe:Drosophila_2:1632346_at:670:137; Interrogation_Position=1664; Antisense; ACGAGGAACGCGAACTGCTAGCACT
>probe:Drosophila_2:1632346_at:13:329; Interrogation_Position=1770; Antisense; GCGTGATCTTCAACTGCTTAGGGCA
>probe:Drosophila_2:1632346_at:308:107; Interrogation_Position=1794; Antisense; AGAAAGACAGCGACGCCTCTGCGAG
>probe:Drosophila_2:1632346_at:167:37; Interrogation_Position=1822; Antisense; ATCATCAGCTCCCAGAGAAGGCTCA
>probe:Drosophila_2:1632346_at:491:641; Interrogation_Position=1866; Antisense; TCTGCCGGATGAGTTGCGTGAGCTT
>probe:Drosophila_2:1632346_at:348:117; Interrogation_Position=1886; Antisense; AGCTTTATGGGCTTTACCAGCAGGA
>probe:Drosophila_2:1632346_at:424:29; Interrogation_Position=1912; Antisense; ATACATGCTGGCGTGGTAACACCCA
>probe:Drosophila_2:1632346_at:424:613; Interrogation_Position=1950; Antisense; TGAACGGAAACTACCGCCCATCTAT
>probe:Drosophila_2:1632346_at:676:321; Interrogation_Position=1965; Antisense; GCCCATCTATACTGCGGGATCTGAC
>probe:Drosophila_2:1632346_at:284:169; Interrogation_Position=2054; Antisense; AAATGGATCCTGTCGACCGAGTCAT
>probe:Drosophila_2:1632346_at:82:161; Interrogation_Position=2122; Antisense; ACAAGTGCGAATGTTCCAGCCGGAG
>probe:Drosophila_2:1632346_at:153:437; Interrogation_Position=2144; Antisense; GAGGATCACGTCGACCTTCGTTAAG
>probe:Drosophila_2:1632346_at:313:223; Interrogation_Position=2166; Antisense; AAGGGTGGCCAGGAATCCACATCCA

Paste this into a BLAST search page for me
GATGAACTTCCGGAGCGCATTAGCAACGAGGAACGCGAACTGCTAGCACTGCGTGATCTTCAACTGCTTAGGGCAAGAAAGACAGCGACGCCTCTGCGAGATCATCAGCTCCCAGAGAAGGCTCATCTGCCGGATGAGTTGCGTGAGCTTAGCTTTATGGGCTTTACCAGCAGGAATACATGCTGGCGTGGTAACACCCATGAACGGAAACTACCGCCCATCTATGCCCATCTATACTGCGGGATCTGACAAATGGATCCTGTCGACCGAGTCATACAAGTGCGAATGTTCCAGCCGGAGGAGGATCACGTCGACCTTCGTTAAGAAGGGTGGCCAGGAATCCACATCCA

Full Affymetrix probeset data:

Annotations for 1632346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime