FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632347_at:

>probe:Drosophila_2:1632347_at:14:149; Interrogation_Position=1456; Antisense; ACTTGTCAAACCCTTTTTGCTCCTG
>probe:Drosophila_2:1632347_at:656:693; Interrogation_Position=1471; Antisense; TTTGCTCCTGTTCCCGAAAATCGAA
>probe:Drosophila_2:1632347_at:148:45; Interrogation_Position=1490; Antisense; ATCGAACCTGTTCAGATGCTGGCAT
>probe:Drosophila_2:1632347_at:348:551; Interrogation_Position=1516; Antisense; GGAGAATCCCAATGTCCATGTGATA
>probe:Drosophila_2:1632347_at:512:339; Interrogation_Position=1541; Antisense; GCTACAAGCTGCTTAGCTCCAATCA
>probe:Drosophila_2:1632347_at:463:363; Interrogation_Position=1612; Antisense; GAATTCCTTAACCATCACAACTTGC
>probe:Drosophila_2:1632347_at:172:429; Interrogation_Position=1639; Antisense; GAGTTGTGCCATAATCTTACACTGA
>probe:Drosophila_2:1632347_at:481:107; Interrogation_Position=1696; Antisense; AGAAAATTATCTAGTGGCAGCACCT
>probe:Drosophila_2:1632347_at:438:521; Interrogation_Position=1709; Antisense; GTGGCAGCACCTATAGAGCATATTT
>probe:Drosophila_2:1632347_at:533:419; Interrogation_Position=1724; Antisense; GAGCATATTTCAGTGCCAACCCAAA
>probe:Drosophila_2:1632347_at:69:615; Interrogation_Position=1752; Antisense; TGCAGAATTTTCCACAACTATCCGC
>probe:Drosophila_2:1632347_at:90:685; Interrogation_Position=1770; Antisense; TATCCGCTACGCTAATAATCGCCAA
>probe:Drosophila_2:1632347_at:206:595; Interrogation_Position=1812; Antisense; TGTGGAGTCCATAAACCGATTGAAT
>probe:Drosophila_2:1632347_at:716:239; Interrogation_Position=1915; Antisense; AATCACAGCACTTCAGAGGTCACAA

Paste this into a BLAST search page for me
ACTTGTCAAACCCTTTTTGCTCCTGTTTGCTCCTGTTCCCGAAAATCGAAATCGAACCTGTTCAGATGCTGGCATGGAGAATCCCAATGTCCATGTGATAGCTACAAGCTGCTTAGCTCCAATCAGAATTCCTTAACCATCACAACTTGCGAGTTGTGCCATAATCTTACACTGAAGAAAATTATCTAGTGGCAGCACCTGTGGCAGCACCTATAGAGCATATTTGAGCATATTTCAGTGCCAACCCAAATGCAGAATTTTCCACAACTATCCGCTATCCGCTACGCTAATAATCGCCAATGTGGAGTCCATAAACCGATTGAATAATCACAGCACTTCAGAGGTCACAA

Full Affymetrix probeset data:

Annotations for 1632347_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720