FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632348_at:

>probe:Drosophila_2:1632348_at:52:45; Interrogation_Position=1030; Antisense; ATCGCATGCAGTTTCTGGCCGAGCA
>probe:Drosophila_2:1632348_at:285:311; Interrogation_Position=1165; Antisense; CCAAGGATCGCGGTATGTTCATATA
>probe:Drosophila_2:1632348_at:279:485; Interrogation_Position=1177; Antisense; GTATGTTCATATACACCGGCCACGA
>probe:Drosophila_2:1632348_at:164:501; Interrogation_Position=1209; Antisense; GTCGGCAATATCCTGATGGCCTTGG
>probe:Drosophila_2:1632348_at:622:583; Interrogation_Position=1239; Antisense; TGGAAGCGCCAGATGCCACGGTTCG
>probe:Drosophila_2:1632348_at:431:139; Interrogation_Position=1256; Antisense; ACGGTTCGCGGTGATGGCCATTTTC
>probe:Drosophila_2:1632348_at:153:577; Interrogation_Position=1271; Antisense; GGCCATTTTCGAGACGCATAGGGAT
>probe:Drosophila_2:1632348_at:723:145; Interrogation_Position=1312; Antisense; ACTATGTGGAGATCTTCCTCCGCAA
>probe:Drosophila_2:1632348_at:410:33; Interrogation_Position=1407; Antisense; ATCAAGCTGAGTGCCGATGTGCTGC
>probe:Drosophila_2:1632348_at:308:101; Interrogation_Position=1450; Antisense; AGAGATGCCGGCCACATGACTCGAA
>probe:Drosophila_2:1632348_at:672:55; Interrogation_Position=1465; Antisense; ATGACTCGAACTTCGTGGAGCCACC
>probe:Drosophila_2:1632348_at:443:133; Interrogation_Position=1487; Antisense; ACCGCCGCGCGTAATCGATCAGAAT
>probe:Drosophila_2:1632348_at:208:667; Interrogation_Position=947; Antisense; TATCAATTCCCTATACATAACCCTC
>probe:Drosophila_2:1632348_at:215:363; Interrogation_Position=984; Antisense; GAATTCGGCTACAAGTTGCCCGACT

Paste this into a BLAST search page for me
ATCGCATGCAGTTTCTGGCCGAGCACCAAGGATCGCGGTATGTTCATATAGTATGTTCATATACACCGGCCACGAGTCGGCAATATCCTGATGGCCTTGGTGGAAGCGCCAGATGCCACGGTTCGACGGTTCGCGGTGATGGCCATTTTCGGCCATTTTCGAGACGCATAGGGATACTATGTGGAGATCTTCCTCCGCAAATCAAGCTGAGTGCCGATGTGCTGCAGAGATGCCGGCCACATGACTCGAAATGACTCGAACTTCGTGGAGCCACCACCGCCGCGCGTAATCGATCAGAATTATCAATTCCCTATACATAACCCTCGAATTCGGCTACAAGTTGCCCGACT

Full Affymetrix probeset data:

Annotations for 1632348_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720