FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632350_at:

>probe:Drosophila_2:1632350_at:276:37; Interrogation_Position=362; Antisense; ATCATTGCCGCAATAGCGAGCAGTT
>probe:Drosophila_2:1632350_at:404:115; Interrogation_Position=380; Antisense; AGCAGTTCCGCAACGTGGCGCAGGT
>probe:Drosophila_2:1632350_at:543:273; Interrogation_Position=570; Antisense; CATTATAGCATTTAGTCCGCCCAAT
>probe:Drosophila_2:1632350_at:669:503; Interrogation_Position=584; Antisense; GTCCGCCCAATAACAGCAAGTGCAT
>probe:Drosophila_2:1632350_at:181:111; Interrogation_Position=598; Antisense; AGCAAGTGCATTGCCTACTTCACAC
>probe:Drosophila_2:1632350_at:299:667; Interrogation_Position=613; Antisense; TACTTCACACAGCTTGTCCGGGATA
>probe:Drosophila_2:1632350_at:358:197; Interrogation_Position=688; Antisense; AACGAGGCCGGTCAGTCGCTGTCCA
>probe:Drosophila_2:1632350_at:83:517; Interrogation_Position=713; Antisense; GTGTCCACCAGTACATGACCTGCAA
>probe:Drosophila_2:1632350_at:574:609; Interrogation_Position=728; Antisense; TGACCTGCAACTTTGTCCGGACAAA
>probe:Drosophila_2:1632350_at:697:167; Interrogation_Position=750; Antisense; AAATGATGTCAATGCCCCGGTCTAC
>probe:Drosophila_2:1632350_at:486:477; Interrogation_Position=823; Antisense; GTTTTTATTAACCTGTGCTCCGTCA
>probe:Drosophila_2:1632350_at:584:581; Interrogation_Position=872; Antisense; TGGCTGGCCTCTTCTGAACTGGCGG
>probe:Drosophila_2:1632350_at:144:383; Interrogation_Position=887; Antisense; GAACTGGCGGACTCTGCAATTCCAA
>probe:Drosophila_2:1632350_at:620:281; Interrogation_Position=900; Antisense; CTGCAATTCCAAGGCCAATCACTAA

Paste this into a BLAST search page for me
ATCATTGCCGCAATAGCGAGCAGTTAGCAGTTCCGCAACGTGGCGCAGGTCATTATAGCATTTAGTCCGCCCAATGTCCGCCCAATAACAGCAAGTGCATAGCAAGTGCATTGCCTACTTCACACTACTTCACACAGCTTGTCCGGGATAAACGAGGCCGGTCAGTCGCTGTCCAGTGTCCACCAGTACATGACCTGCAATGACCTGCAACTTTGTCCGGACAAAAAATGATGTCAATGCCCCGGTCTACGTTTTTATTAACCTGTGCTCCGTCATGGCTGGCCTCTTCTGAACTGGCGGGAACTGGCGGACTCTGCAATTCCAACTGCAATTCCAAGGCCAATCACTAA

Full Affymetrix probeset data:

Annotations for 1632350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720