FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632351_at:

>probe:Drosophila_2:1632351_at:298:617; Interrogation_Position=220; Antisense; TGCTCAAGAAGCTGGATTTCCTCAA
>probe:Drosophila_2:1632351_at:547:543; Interrogation_Position=233; Antisense; GGATTTCCTCAATTTGTTCACCGAA
>probe:Drosophila_2:1632351_at:259:553; Interrogation_Position=335; Antisense; GGAGCTGGCCTTTTTCGAGGCCAAA
>probe:Drosophila_2:1632351_at:350:213; Interrogation_Position=429; Antisense; AAGACCACAGTGAAGCCTTGCTATG
>probe:Drosophila_2:1632351_at:107:315; Interrogation_Position=443; Antisense; GCCTTGCTATGGCTACCAGGAACAG
>probe:Drosophila_2:1632351_at:589:127; Interrogation_Position=469; Antisense; ACCAGGACACTGCTAAATACCACTC
>probe:Drosophila_2:1632351_at:489:649; Interrogation_Position=492; Antisense; TCAGCAGAGGCCACCGAGGCGGAAT
>probe:Drosophila_2:1632351_at:526:563; Interrogation_Position=530; Antisense; GGAAGTCACTGAAAAACCCAGCCGA
>probe:Drosophila_2:1632351_at:111:419; Interrogation_Position=572; Antisense; GAGCTACGACAGACGAACCTATTCA
>probe:Drosophila_2:1632351_at:544:687; Interrogation_Position=591; Antisense; TATTCACTGCCCACAATTTACGATG
>probe:Drosophila_2:1632351_at:163:137; Interrogation_Position=622; Antisense; ACGATTCGGCGGAGGGTACTCGCTA
>probe:Drosophila_2:1632351_at:568:669; Interrogation_Position=638; Antisense; TACTCGCTACTTTACCTGAACCAAG
>probe:Drosophila_2:1632351_at:26:211; Interrogation_Position=660; Antisense; AAGAACCCGGCTAATTGGCTCGGAT
>probe:Drosophila_2:1632351_at:11:701; Interrogation_Position=706; Antisense; TTTATTGCATTTTCTCTGCCTGTCA

Paste this into a BLAST search page for me
TGCTCAAGAAGCTGGATTTCCTCAAGGATTTCCTCAATTTGTTCACCGAAGGAGCTGGCCTTTTTCGAGGCCAAAAAGACCACAGTGAAGCCTTGCTATGGCCTTGCTATGGCTACCAGGAACAGACCAGGACACTGCTAAATACCACTCTCAGCAGAGGCCACCGAGGCGGAATGGAAGTCACTGAAAAACCCAGCCGAGAGCTACGACAGACGAACCTATTCATATTCACTGCCCACAATTTACGATGACGATTCGGCGGAGGGTACTCGCTATACTCGCTACTTTACCTGAACCAAGAAGAACCCGGCTAATTGGCTCGGATTTTATTGCATTTTCTCTGCCTGTCA

Full Affymetrix probeset data:

Annotations for 1632351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720