Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632353_at:

>probe:Drosophila_2:1632353_at:599:187; Interrogation_Position=3377; Antisense; AACACGATAGTGACAGCAGCGCCGA
>probe:Drosophila_2:1632353_at:547:567; Interrogation_Position=3409; Antisense; GGCACTTCAGCGACCCACAGCGAGG
>probe:Drosophila_2:1632353_at:445:77; Interrogation_Position=3461; Antisense; AGGTCGAAGCAAGGTCAAGGCGCCC
>probe:Drosophila_2:1632353_at:125:467; Interrogation_Position=3509; Antisense; GTTGTAATATATTTCACCCCAGCCG
>probe:Drosophila_2:1632353_at:405:587; Interrogation_Position=3560; Antisense; TGGAGCGAGGATACGGCCTAGATAT
>probe:Drosophila_2:1632353_at:119:219; Interrogation_Position=3591; Antisense; AAGTCCTTGGAAGCGCTATGACGAT
>probe:Drosophila_2:1632353_at:94:279; Interrogation_Position=3606; Antisense; CTATGACGATGAGTGGAGATCCCGA
>probe:Drosophila_2:1632353_at:127:549; Interrogation_Position=3620; Antisense; GGAGATCCCGAATCAAAGTTAGAGT
>probe:Drosophila_2:1632353_at:233:429; Interrogation_Position=3641; Antisense; GAGTATTTTCGCATTTGGTAGCTTT
>probe:Drosophila_2:1632353_at:473:299; Interrogation_Position=3692; Antisense; CCAAAGGAGTGGAGCTACGCGTAGT
>probe:Drosophila_2:1632353_at:14:483; Interrogation_Position=3743; Antisense; GTATTCACAATTCTCTTTTTTGCTT
>probe:Drosophila_2:1632353_at:147:569; Interrogation_Position=3806; Antisense; GGCTCTTCCTTTGCTAGTTGTAGTT
>probe:Drosophila_2:1632353_at:307:303; Interrogation_Position=3869; Antisense; CCGAAGAATGGGTTGTCAGGCGATT
>probe:Drosophila_2:1632353_at:357:397; Interrogation_Position=3894; Antisense; GACAACGTTATAATCGATGTGCAAC

Paste this into a BLAST search page for me
AACACGATAGTGACAGCAGCGCCGAGGCACTTCAGCGACCCACAGCGAGGAGGTCGAAGCAAGGTCAAGGCGCCCGTTGTAATATATTTCACCCCAGCCGTGGAGCGAGGATACGGCCTAGATATAAGTCCTTGGAAGCGCTATGACGATCTATGACGATGAGTGGAGATCCCGAGGAGATCCCGAATCAAAGTTAGAGTGAGTATTTTCGCATTTGGTAGCTTTCCAAAGGAGTGGAGCTACGCGTAGTGTATTCACAATTCTCTTTTTTGCTTGGCTCTTCCTTTGCTAGTTGTAGTTCCGAAGAATGGGTTGTCAGGCGATTGACAACGTTATAATCGATGTGCAAC

Full Affymetrix probeset data:

Annotations for 1632353_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime