Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632355_at:

>probe:Drosophila_2:1632355_at:159:275; Interrogation_Position=4279; Antisense; CTTGTGTGCTGCGTATTTTGCAGTT
>probe:Drosophila_2:1632355_at:725:323; Interrogation_Position=4318; Antisense; GCGAGTATTTACTGACTCATCGTAT
>probe:Drosophila_2:1632355_at:729:289; Interrogation_Position=4338; Antisense; CGTATACATAGTTACCAAGTGCATA
>probe:Drosophila_2:1632355_at:412:57; Interrogation_Position=4386; Antisense; ATGAGTATATACATTTTCACACCCC
>probe:Drosophila_2:1632355_at:255:665; Interrogation_Position=4429; Antisense; TACATATATAACCTGGCCTTTGTTT
>probe:Drosophila_2:1632355_at:236:725; Interrogation_Position=4448; Antisense; TTGTTTGTTTACGTCGTGGCGCGTG
>probe:Drosophila_2:1632355_at:283:501; Interrogation_Position=4460; Antisense; GTCGTGGCGCGTGTTATAAATTGTA
>probe:Drosophila_2:1632355_at:684:669; Interrogation_Position=4571; Antisense; TTTAATTGTAGGCATTGGACGGGCA
>probe:Drosophila_2:1632355_at:114:183; Interrogation_Position=4663; Antisense; AAAACCAATCGGACCCATTGCTAAG
>probe:Drosophila_2:1632355_at:338:553; Interrogation_Position=4673; Antisense; GGACCCATTGCTAAGTTTTTGATTA
>probe:Drosophila_2:1632355_at:719:687; Interrogation_Position=4696; Antisense; TATTCTTTAAATAGTCCTTTGACAC
>probe:Drosophila_2:1632355_at:460:691; Interrogation_Position=4713; Antisense; TTTGACACACTTATCGACTTACCCG
>probe:Drosophila_2:1632355_at:704:401; Interrogation_Position=4728; Antisense; GACTTACCCGCTCGCATATTTTATA
>probe:Drosophila_2:1632355_at:726:325; Interrogation_Position=4758; Antisense; GCGAGCAAAATGATTGCCTACCCAA

Paste this into a BLAST search page for me
CTTGTGTGCTGCGTATTTTGCAGTTGCGAGTATTTACTGACTCATCGTATCGTATACATAGTTACCAAGTGCATAATGAGTATATACATTTTCACACCCCTACATATATAACCTGGCCTTTGTTTTTGTTTGTTTACGTCGTGGCGCGTGGTCGTGGCGCGTGTTATAAATTGTATTTAATTGTAGGCATTGGACGGGCAAAAACCAATCGGACCCATTGCTAAGGGACCCATTGCTAAGTTTTTGATTATATTCTTTAAATAGTCCTTTGACACTTTGACACACTTATCGACTTACCCGGACTTACCCGCTCGCATATTTTATAGCGAGCAAAATGATTGCCTACCCAA

Full Affymetrix probeset data:

Annotations for 1632355_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime