FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632356_at:

>probe:Drosophila_2:1632356_at:668:365; Interrogation_Position=1031; Antisense; GAATCACCCGGAGTTTATGCACTTT
>probe:Drosophila_2:1632356_at:297:527; Interrogation_Position=1125; Antisense; GGGAACGTATCACAGTCACCATATA
>probe:Drosophila_2:1632356_at:625:21; Interrogation_Position=1145; Antisense; ATATACGGCAATACACTCGACACGA
>probe:Drosophila_2:1632356_at:310:617; Interrogation_Position=1173; Antisense; TGCTGTTCAAACTGCTATCCATTAG
>probe:Drosophila_2:1632356_at:588:47; Interrogation_Position=1189; Antisense; ATCCATTAGTGCCTTTTGCGCGTTT
>probe:Drosophila_2:1632356_at:382:721; Interrogation_Position=1204; Antisense; TTGCGCGTTTGTTAACCGACTGGAG
>probe:Drosophila_2:1632356_at:129:689; Interrogation_Position=666; Antisense; TATTTGCCTCTTTGTAGTGCTCATT
>probe:Drosophila_2:1632356_at:631:85; Interrogation_Position=681; Antisense; AGTGCTCATTGCCACGTATAGCGAA
>probe:Drosophila_2:1632356_at:323:685; Interrogation_Position=697; Antisense; TATAGCGAACTACACCATTGCACTC
>probe:Drosophila_2:1632356_at:527:207; Interrogation_Position=745; Antisense; AAGCTCAGACTTCATTCTGTCCATG
>probe:Drosophila_2:1632356_at:463:141; Interrogation_Position=870; Antisense; ACGGCATTTCCGATTTCATTGGCTG
>probe:Drosophila_2:1632356_at:549:573; Interrogation_Position=890; Antisense; GGCTGTGTGCTATTATCTACGGATT
>probe:Drosophila_2:1632356_at:278:585; Interrogation_Position=951; Antisense; TGGTTTTAACTTCCTCATCATTTCC
>probe:Drosophila_2:1632356_at:45:521; Interrogation_Position=996; Antisense; GTGGACTATTTTTGCGATTCTTTCT

Paste this into a BLAST search page for me
GAATCACCCGGAGTTTATGCACTTTGGGAACGTATCACAGTCACCATATAATATACGGCAATACACTCGACACGATGCTGTTCAAACTGCTATCCATTAGATCCATTAGTGCCTTTTGCGCGTTTTTGCGCGTTTGTTAACCGACTGGAGTATTTGCCTCTTTGTAGTGCTCATTAGTGCTCATTGCCACGTATAGCGAATATAGCGAACTACACCATTGCACTCAAGCTCAGACTTCATTCTGTCCATGACGGCATTTCCGATTTCATTGGCTGGGCTGTGTGCTATTATCTACGGATTTGGTTTTAACTTCCTCATCATTTCCGTGGACTATTTTTGCGATTCTTTCT

Full Affymetrix probeset data:

Annotations for 1632356_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720