FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632358_at:

>probe:Drosophila_2:1632358_at:25:271; Interrogation_Position=2365; Antisense; CATTTAAGAAATGCCCTTCTCCAGG
>probe:Drosophila_2:1632358_at:560:487; Interrogation_Position=2419; Antisense; GTAGCCACACCACCGTCTGATGAAA
>probe:Drosophila_2:1632358_at:149:391; Interrogation_Position=2440; Antisense; GAAACTGCGCTCAAGGAGCTCCCGG
>probe:Drosophila_2:1632358_at:293:257; Interrogation_Position=2475; Antisense; CACTCCTTGCTTGCAGGGTCAGGTG
>probe:Drosophila_2:1632358_at:51:591; Interrogation_Position=2498; Antisense; TGGTGGGTAGCACAACAACGCCGTT
>probe:Drosophila_2:1632358_at:330:185; Interrogation_Position=2511; Antisense; AACAACGCCGTTGAAGACCAAGCTG
>probe:Drosophila_2:1632358_at:510:207; Interrogation_Position=2530; Antisense; AAGCTGGCTGCAAGTTCTACGCTCA
>probe:Drosophila_2:1632358_at:444:131; Interrogation_Position=2571; Antisense; ACTTACGGCCTTGCTGAACAACGGG
>probe:Drosophila_2:1632358_at:672:593; Interrogation_Position=2606; Antisense; TGGGAGCAACTCCTACAGGCAACTC
>probe:Drosophila_2:1632358_at:399:245; Interrogation_Position=2684; Antisense; AATTCTTATGCTTGTTTGTTACCAA
>probe:Drosophila_2:1632358_at:27:141; Interrogation_Position=2715; Antisense; ACGGTGATTTTAGGTTGCTGATTAA
>probe:Drosophila_2:1632358_at:646:659; Interrogation_Position=2793; Antisense; TAAAAGGCGGCCCATAACCTTCATG
>probe:Drosophila_2:1632358_at:550:31; Interrogation_Position=2806; Antisense; ATAACCTTCATGTCTATTTCTGCGC
>probe:Drosophila_2:1632358_at:612:695; Interrogation_Position=2822; Antisense; TTTCTGCGCGTAACATTTAATCATG

Paste this into a BLAST search page for me
CATTTAAGAAATGCCCTTCTCCAGGGTAGCCACACCACCGTCTGATGAAAGAAACTGCGCTCAAGGAGCTCCCGGCACTCCTTGCTTGCAGGGTCAGGTGTGGTGGGTAGCACAACAACGCCGTTAACAACGCCGTTGAAGACCAAGCTGAAGCTGGCTGCAAGTTCTACGCTCAACTTACGGCCTTGCTGAACAACGGGTGGGAGCAACTCCTACAGGCAACTCAATTCTTATGCTTGTTTGTTACCAAACGGTGATTTTAGGTTGCTGATTAATAAAAGGCGGCCCATAACCTTCATGATAACCTTCATGTCTATTTCTGCGCTTTCTGCGCGTAACATTTAATCATG

Full Affymetrix probeset data:

Annotations for 1632358_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720