FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632359_at:

>probe:Drosophila_2:1632359_at:585:227; Interrogation_Position=190; Antisense; AAGGCCAGCCATGTCAACATAGTTG
>probe:Drosophila_2:1632359_at:504:25; Interrogation_Position=208; Antisense; ATAGTTGAGCTCTACGGCACATCGA
>probe:Drosophila_2:1632359_at:182:51; Interrogation_Position=243; Antisense; ATGCGCCCTGCTGTTGATGGAATTC
>probe:Drosophila_2:1632359_at:398:3; Interrogation_Position=264; Antisense; ATTCGTAGACGGTGGATCTCTGTCC
>probe:Drosophila_2:1632359_at:385:639; Interrogation_Position=282; Antisense; TCTGTCCAGTTTTCTGCACGCGAAA
>probe:Drosophila_2:1632359_at:254:359; Interrogation_Position=308; Antisense; GCAAGCCAAGTTATTCGCATGCCCA
>probe:Drosophila_2:1632359_at:274:577; Interrogation_Position=345; Antisense; GGCGCATCAGATCGCTCAGGGCATA
>probe:Drosophila_2:1632359_at:6:83; Interrogation_Position=362; Antisense; AGGGCATAGCCTATCTGCATGGCAT
>probe:Drosophila_2:1632359_at:671:203; Interrogation_Position=418; Antisense; AAGCCACTCAATACACTGCTATGCG
>probe:Drosophila_2:1632359_at:300:19; Interrogation_Position=470; Antisense; ATTTCGGAACTGTTGTGGACCTATC
>probe:Drosophila_2:1632359_at:5:587; Interrogation_Position=485; Antisense; TGGACCTATCCCAATCGATATCGTG
>probe:Drosophila_2:1632359_at:309:361; Interrogation_Position=509; Antisense; GCAATGCGGGCACCTGCAGATACAA
>probe:Drosophila_2:1632359_at:362:691; Interrogation_Position=677; Antisense; TATTGTCGCGCAAGGAGCCATTTGA
>probe:Drosophila_2:1632359_at:537:135; Interrogation_Position=712; Antisense; ACGCTTTTTGAACTGTACATGGCTA

Paste this into a BLAST search page for me
AAGGCCAGCCATGTCAACATAGTTGATAGTTGAGCTCTACGGCACATCGAATGCGCCCTGCTGTTGATGGAATTCATTCGTAGACGGTGGATCTCTGTCCTCTGTCCAGTTTTCTGCACGCGAAAGCAAGCCAAGTTATTCGCATGCCCAGGCGCATCAGATCGCTCAGGGCATAAGGGCATAGCCTATCTGCATGGCATAAGCCACTCAATACACTGCTATGCGATTTCGGAACTGTTGTGGACCTATCTGGACCTATCCCAATCGATATCGTGGCAATGCGGGCACCTGCAGATACAATATTGTCGCGCAAGGAGCCATTTGAACGCTTTTTGAACTGTACATGGCTA

Full Affymetrix probeset data:

Annotations for 1632359_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720