Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632361_at:

>probe:Drosophila_2:1632361_at:240:385; Interrogation_Position=2823; Antisense; GAACTTATTGCGATTGCGCAGCCAC
>probe:Drosophila_2:1632361_at:317:465; Interrogation_Position=2834; Antisense; GATTGCGCAGCCACTGAAACGAAAA
>probe:Drosophila_2:1632361_at:606:491; Interrogation_Position=2876; Antisense; GTAATCAATAACTACGTGTTACCTA
>probe:Drosophila_2:1632361_at:255:625; Interrogation_Position=2920; Antisense; TGCCGAAATGGCTTATTGCAAGGAT
>probe:Drosophila_2:1632361_at:404:543; Interrogation_Position=2941; Antisense; GGATTTTAGCCAGAACTTATACAAA
>probe:Drosophila_2:1632361_at:259:691; Interrogation_Position=2982; Antisense; TTTGAACTCGAAATACACACGTAGG
>probe:Drosophila_2:1632361_at:130:485; Interrogation_Position=3002; Antisense; GTAGGTTATAGCTAGACGTCAGATT
>probe:Drosophila_2:1632361_at:307:263; Interrogation_Position=3067; Antisense; CAGAACGTTTTTGATTGCACACTAA
>probe:Drosophila_2:1632361_at:72:617; Interrogation_Position=3082; Antisense; TGCACACTAATTACCCCGTCATTTG
>probe:Drosophila_2:1632361_at:444:303; Interrogation_Position=3097; Antisense; CCGTCATTTGTACGCCCTTAATTGC
>probe:Drosophila_2:1632361_at:99:489; Interrogation_Position=3106; Antisense; GTACGCCCTTAATTGCTAATATCAA
>probe:Drosophila_2:1632361_at:567:683; Interrogation_Position=3125; Antisense; TATCAATCAATCTCCAAAGTGTTTT
>probe:Drosophila_2:1632361_at:416:255; Interrogation_Position=3156; Antisense; CAAAAAAGGCAACTTCAGTGTGTTT
>probe:Drosophila_2:1632361_at:429:121; Interrogation_Position=3208; Antisense; ACGAATTACTATGCGGATGTTTACA

Paste this into a BLAST search page for me
GAACTTATTGCGATTGCGCAGCCACGATTGCGCAGCCACTGAAACGAAAAGTAATCAATAACTACGTGTTACCTATGCCGAAATGGCTTATTGCAAGGATGGATTTTAGCCAGAACTTATACAAATTTGAACTCGAAATACACACGTAGGGTAGGTTATAGCTAGACGTCAGATTCAGAACGTTTTTGATTGCACACTAATGCACACTAATTACCCCGTCATTTGCCGTCATTTGTACGCCCTTAATTGCGTACGCCCTTAATTGCTAATATCAATATCAATCAATCTCCAAAGTGTTTTCAAAAAAGGCAACTTCAGTGTGTTTACGAATTACTATGCGGATGTTTACA

Full Affymetrix probeset data:

Annotations for 1632361_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime