FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632362_at:

>probe:Drosophila_2:1632362_at:20:81; Interrogation_Position=122; Antisense; AGGTGACCAAAGTTCTGCGCCGGCA
>probe:Drosophila_2:1632362_at:58:159; Interrogation_Position=146; Antisense; ACAAGCGTTATCTGGCATTTCCGGA
>probe:Drosophila_2:1632362_at:98:409; Interrogation_Position=201; Antisense; GACGATCGGCATGATTGGCAATCCA
>probe:Drosophila_2:1632362_at:454:59; Interrogation_Position=227; Antisense; ATGTTGACTATCTCAGCTGGGCGGT
>probe:Drosophila_2:1632362_at:100:45; Interrogation_Position=351; Antisense; ATCCCGGCGAGCTTTTTACGATGAG
>probe:Drosophila_2:1632362_at:507:697; Interrogation_Position=402; Antisense; TTTCAATGGTCGTTCGTGTGTGGCT
>probe:Drosophila_2:1632362_at:112:597; Interrogation_Position=418; Antisense; TGTGTGGCTCGAGCTCTATGCGAAA
>probe:Drosophila_2:1632362_at:608:219; Interrogation_Position=441; Antisense; AAGTGCCAAGTTCATGTTGCCGTCG
>probe:Drosophila_2:1632362_at:169:93; Interrogation_Position=491; Antisense; AGTTGGTCAGGACTGTCTTTAGCCT
>probe:Drosophila_2:1632362_at:592:365; Interrogation_Position=569; Antisense; GAATCTACCGTCGATCCAAGCGGAG
>probe:Drosophila_2:1632362_at:321:553; Interrogation_Position=590; Antisense; GGAGCTCACGGGATTGCCATGAAAT
>probe:Drosophila_2:1632362_at:677:643; Interrogation_Position=614; Antisense; TCTATCCAGGATGTCAGTTTTCACT
>probe:Drosophila_2:1632362_at:428:89; Interrogation_Position=629; Antisense; AGTTTTCACTACTGGCTTTGGCATT
>probe:Drosophila_2:1632362_at:526:329; Interrogation_Position=667; Antisense; GCGGCCACAACCACGAAGTTTAGTT

Paste this into a BLAST search page for me
AGGTGACCAAAGTTCTGCGCCGGCAACAAGCGTTATCTGGCATTTCCGGAGACGATCGGCATGATTGGCAATCCAATGTTGACTATCTCAGCTGGGCGGTATCCCGGCGAGCTTTTTACGATGAGTTTCAATGGTCGTTCGTGTGTGGCTTGTGTGGCTCGAGCTCTATGCGAAAAAGTGCCAAGTTCATGTTGCCGTCGAGTTGGTCAGGACTGTCTTTAGCCTGAATCTACCGTCGATCCAAGCGGAGGGAGCTCACGGGATTGCCATGAAATTCTATCCAGGATGTCAGTTTTCACTAGTTTTCACTACTGGCTTTGGCATTGCGGCCACAACCACGAAGTTTAGTT

Full Affymetrix probeset data:

Annotations for 1632362_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720