FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632364_at:

>probe:Drosophila_2:1632364_at:278:1; Interrogation_Position=2122; Antisense; AGTTTCGTCGAATGGAACCGCCTGC
>probe:Drosophila_2:1632364_at:477:397; Interrogation_Position=2197; Antisense; GACAACTTCACGGAGCGCATGGCGA
>probe:Drosophila_2:1632364_at:708:75; Interrogation_Position=2231; Antisense; AGGAGCAGGCTCACCGATCGGAAGT
>probe:Drosophila_2:1632364_at:392:419; Interrogation_Position=2281; Antisense; GAGCAGGCCAAGCAAACCATCGAAC
>probe:Drosophila_2:1632364_at:31:45; Interrogation_Position=2299; Antisense; ATCGAACTCCTGTACAATGTGCTCA
>probe:Drosophila_2:1632364_at:44:231; Interrogation_Position=2314; Antisense; AATGTGCTCATGTTCCCGGACAAGG
>probe:Drosophila_2:1632364_at:180:593; Interrogation_Position=2345; Antisense; TGGTGGATCCGTTCATCGCCAAGCT
>probe:Drosophila_2:1632364_at:3:617; Interrogation_Position=2384; Antisense; TGCAGCTGAGCTGGGATCATCGCCT
>probe:Drosophila_2:1632364_at:475:453; Interrogation_Position=2398; Antisense; GATCATCGCCTACTGCAGATGGAGA
>probe:Drosophila_2:1632364_at:398:423; Interrogation_Position=2419; Antisense; GAGAAATTGCGCTCCATCTGCATTC
>probe:Drosophila_2:1632364_at:430:97; Interrogation_Position=2447; Antisense; AGATCGCCCTGTTTCTGAACGAAGT
>probe:Drosophila_2:1632364_at:101:469; Interrogation_Position=2498; Antisense; GTTGCGTGCGCCTGGCAGATGAAAT
>probe:Drosophila_2:1632364_at:166:161; Interrogation_Position=2564; Antisense; ACAAGCTGGCAGAGCTTCTGGCCAA
>probe:Drosophila_2:1632364_at:623:283; Interrogation_Position=2611; Antisense; CTGCTCAACTCGAAACTGGATCCAT

Paste this into a BLAST search page for me
AGTTTCGTCGAATGGAACCGCCTGCGACAACTTCACGGAGCGCATGGCGAAGGAGCAGGCTCACCGATCGGAAGTGAGCAGGCCAAGCAAACCATCGAACATCGAACTCCTGTACAATGTGCTCAAATGTGCTCATGTTCCCGGACAAGGTGGTGGATCCGTTCATCGCCAAGCTTGCAGCTGAGCTGGGATCATCGCCTGATCATCGCCTACTGCAGATGGAGAGAGAAATTGCGCTCCATCTGCATTCAGATCGCCCTGTTTCTGAACGAAGTGTTGCGTGCGCCTGGCAGATGAAATACAAGCTGGCAGAGCTTCTGGCCAACTGCTCAACTCGAAACTGGATCCAT

Full Affymetrix probeset data:

Annotations for 1632364_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720