FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632367_at:

>probe:Drosophila_2:1632367_at:718:647; Interrogation_Position=277; Antisense; TCATCCAATAAGGAGAGCACCTCAA
>probe:Drosophila_2:1632367_at:175:551; Interrogation_Position=288; Antisense; GGAGAGCACCTCAAAAATGTAAGCC
>probe:Drosophila_2:1632367_at:478:419; Interrogation_Position=291; Antisense; GAGCACCTCAAAAATGTAAGCCAAT
>probe:Drosophila_2:1632367_at:519:377; Interrogation_Position=460; Antisense; GAAGCACTGTAACTTGAAACCGCGG
>probe:Drosophila_2:1632367_at:212:113; Interrogation_Position=462; Antisense; AGCACTGTAACTTGAAACCGCGGGA
>probe:Drosophila_2:1632367_at:357:259; Interrogation_Position=464; Antisense; CACTGTAACTTGAAACCGCGGGAAT
>probe:Drosophila_2:1632367_at:398:389; Interrogation_Position=475; Antisense; GAAACCGCGGGAATTAATTGCAAAG
>probe:Drosophila_2:1632367_at:347:595; Interrogation_Position=512; Antisense; TGGGCCAGGCTCTCGGAGAATAGAA
>probe:Drosophila_2:1632367_at:466:65; Interrogation_Position=518; Antisense; AGGCTCTCGGAGAATAGAAAGGATC
>probe:Drosophila_2:1632367_at:619:657; Interrogation_Position=640; Antisense; TAAGTCCAGGCATATCCTTTCCTAA
>probe:Drosophila_2:1632367_at:169:505; Interrogation_Position=643; Antisense; GTCCAGGCATATCCTTTCCTAACAT
>probe:Drosophila_2:1632367_at:190:569; Interrogation_Position=648; Antisense; GGCATATCCTTTCCTAACATTCGAT
>probe:Drosophila_2:1632367_at:247:683; Interrogation_Position=652; Antisense; TATCCTTTCCTAACATTCGATGAAT
>probe:Drosophila_2:1632367_at:647:183; Interrogation_Position=79; Antisense; AAAAGTCTTATTTTTATGCTCTTCT

Paste this into a BLAST search page for me
TCATCCAATAAGGAGAGCACCTCAAGGAGAGCACCTCAAAAATGTAAGCCGAGCACCTCAAAAATGTAAGCCAATGAAGCACTGTAACTTGAAACCGCGGAGCACTGTAACTTGAAACCGCGGGACACTGTAACTTGAAACCGCGGGAATGAAACCGCGGGAATTAATTGCAAAGTGGGCCAGGCTCTCGGAGAATAGAAAGGCTCTCGGAGAATAGAAAGGATCTAAGTCCAGGCATATCCTTTCCTAAGTCCAGGCATATCCTTTCCTAACATGGCATATCCTTTCCTAACATTCGATTATCCTTTCCTAACATTCGATGAATAAAAGTCTTATTTTTATGCTCTTCT

Full Affymetrix probeset data:

Annotations for 1632367_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720