FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632368_at:

>probe:Drosophila_2:1632368_at:256:445; Interrogation_Position=384; Antisense; GATCTGCAAGGAACTAGCCCAAAAA
>probe:Drosophila_2:1632368_at:385:181; Interrogation_Position=436; Antisense; AAAAAGTGCCGAGAGCTGGCAGCAA
>probe:Drosophila_2:1632368_at:254:375; Interrogation_Position=501; Antisense; GAAGTTGCTCAAGAAGGATAAGTGC
>probe:Drosophila_2:1632368_at:32:457; Interrogation_Position=535; Antisense; GATACTTGCGAAGAAGAGAAGCCTT
>probe:Drosophila_2:1632368_at:519:315; Interrogation_Position=555; Antisense; GCCTTGTGAAGAAGAAGATCCTTGC
>probe:Drosophila_2:1632368_at:291:119; Interrogation_Position=589; Antisense; AGCTGTTGCCCCAAAGATCCTTGCG
>probe:Drosophila_2:1632368_at:641:447; Interrogation_Position=604; Antisense; GATCCTTGCGCTAAAAAACCCAAGA
>probe:Drosophila_2:1632368_at:595:247; Interrogation_Position=624; Antisense; CAAGAAAGTTGACCCCTGCAAAAAG
>probe:Drosophila_2:1632368_at:444:545; Interrogation_Position=669; Antisense; GGATCCATGCAAAAAGAAGGCTGTA
>probe:Drosophila_2:1632368_at:394:421; Interrogation_Position=730; Antisense; GAGCAATGCAAAAAGCTGGCCGAGA
>probe:Drosophila_2:1632368_at:609:681; Interrogation_Position=782; Antisense; TATGCAAAAACCTTGCGGCGAAGGA
>probe:Drosophila_2:1632368_at:118:167; Interrogation_Position=872; Antisense; AAATGGACCGATCAAAACTAGCGCG
>probe:Drosophila_2:1632368_at:269:179; Interrogation_Position=886; Antisense; AAACTAGCGCGGACTCATCAAAAAA
>probe:Drosophila_2:1632368_at:277:653; Interrogation_Position=954; Antisense; TAATAAAAACTTTTCCCATCTGGCT

Paste this into a BLAST search page for me
GATCTGCAAGGAACTAGCCCAAAAAAAAAAGTGCCGAGAGCTGGCAGCAAGAAGTTGCTCAAGAAGGATAAGTGCGATACTTGCGAAGAAGAGAAGCCTTGCCTTGTGAAGAAGAAGATCCTTGCAGCTGTTGCCCCAAAGATCCTTGCGGATCCTTGCGCTAAAAAACCCAAGACAAGAAAGTTGACCCCTGCAAAAAGGGATCCATGCAAAAAGAAGGCTGTAGAGCAATGCAAAAAGCTGGCCGAGATATGCAAAAACCTTGCGGCGAAGGAAAATGGACCGATCAAAACTAGCGCGAAACTAGCGCGGACTCATCAAAAAATAATAAAAACTTTTCCCATCTGGCT

Full Affymetrix probeset data:

Annotations for 1632368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720