FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632369_at:

>probe:Drosophila_2:1632369_at:212:63; Interrogation_Position=1376; Antisense; ATGTGCTCTTCATGCAGGGCGACAA
>probe:Drosophila_2:1632369_at:76:379; Interrogation_Position=1408; Antisense; GAAGCGGCTGCGTTTTATGAACCCA
>probe:Drosophila_2:1632369_at:264:43; Interrogation_Position=1432; Antisense; ATCGTGCGCCAGCATTCGGATGATA
>probe:Drosophila_2:1632369_at:671:57; Interrogation_Position=1451; Antisense; ATGATATCATGTCCGTTTCTGCAGC
>probe:Drosophila_2:1632369_at:552:241; Interrogation_Position=1589; Antisense; AATACCACCACCTGTGCATTGTCAA
>probe:Drosophila_2:1632369_at:708:249; Interrogation_Position=1611; Antisense; CAATCTGGTGGTGGGCACACTGTAC
>probe:Drosophila_2:1632369_at:115:601; Interrogation_Position=1631; Antisense; TGTACTGCGCCAAATCCAACTATGA
>probe:Drosophila_2:1632369_at:630:47; Interrogation_Position=1644; Antisense; ATCCAACTATGAGTTCGGCCTATCC
>probe:Drosophila_2:1632369_at:619:397; Interrogation_Position=1717; Antisense; GACACCTGGCTGCATGTGAAGCACT
>probe:Drosophila_2:1632369_at:536:713; Interrogation_Position=1754; Antisense; TTCTCACCGGCATGGCCAAGCAGAA
>probe:Drosophila_2:1632369_at:634:113; Interrogation_Position=1772; Antisense; AGCAGAACATTATCCTGCCCTATGC
>probe:Drosophila_2:1632369_at:47:49; Interrogation_Position=1793; Antisense; ATGCCACCGTGCAGGAGGTCCTCAA
>probe:Drosophila_2:1632369_at:653:191; Interrogation_Position=1816; Antisense; AACTTTCTGCGCTTTTGCGAGTCCT
>probe:Drosophila_2:1632369_at:441:75; Interrogation_Position=1892; Antisense; AGGAGCCACTTACCATTGGCCTGGA

Paste this into a BLAST search page for me
ATGTGCTCTTCATGCAGGGCGACAAGAAGCGGCTGCGTTTTATGAACCCAATCGTGCGCCAGCATTCGGATGATAATGATATCATGTCCGTTTCTGCAGCAATACCACCACCTGTGCATTGTCAACAATCTGGTGGTGGGCACACTGTACTGTACTGCGCCAAATCCAACTATGAATCCAACTATGAGTTCGGCCTATCCGACACCTGGCTGCATGTGAAGCACTTTCTCACCGGCATGGCCAAGCAGAAAGCAGAACATTATCCTGCCCTATGCATGCCACCGTGCAGGAGGTCCTCAAAACTTTCTGCGCTTTTGCGAGTCCTAGGAGCCACTTACCATTGGCCTGGA

Full Affymetrix probeset data:

Annotations for 1632369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720