Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632370_at:

>probe:Drosophila_2:1632370_at:52:657; Interrogation_Position=101; Antisense; TAAGGCAGCCACTATGTCGTATCAA
>probe:Drosophila_2:1632370_at:126:597; Interrogation_Position=115; Antisense; TGTCGTATCAACTGTACCGCAACAC
>probe:Drosophila_2:1632370_at:277:415; Interrogation_Position=164; Antisense; GAGCCTCGACGAGCTGATTCAGTAC
>probe:Drosophila_2:1632370_at:665:87; Interrogation_Position=193; Antisense; AGATTACGCCCGGACTGGCTTTCAA
>probe:Drosophila_2:1632370_at:402:571; Interrogation_Position=209; Antisense; GGCTTTCAAGGTTCTGCTGCAATTC
>probe:Drosophila_2:1632370_at:142:231; Interrogation_Position=249; Antisense; AATGCCCTAAACCAGCGGGTCAAGG
>probe:Drosophila_2:1632370_at:564:673; Interrogation_Position=309; Antisense; TACCGCTTCTGCGACAATGTCTGGA
>probe:Drosophila_2:1632370_at:69:597; Interrogation_Position=326; Antisense; TGTCTGGACTCTCATGCTTAACGAT
>probe:Drosophila_2:1632370_at:639:587; Interrogation_Position=352; Antisense; TGGAGTTCCGCGAAGTGCACGAGAT
>probe:Drosophila_2:1632370_at:426:215; Interrogation_Position=396; Antisense; AAGATCGTGGCCTGCGACGGCAAGA
>probe:Drosophila_2:1632370_at:606:701; Interrogation_Position=40; Antisense; TTTTGCTTGACTTGACAGGTTCGTA
>probe:Drosophila_2:1632370_at:90:253; Interrogation_Position=416; Antisense; CAAGAGCGGCGAGTTCTGAACACCA
>probe:Drosophila_2:1632370_at:65:413; Interrogation_Position=443; Antisense; GACCCGATCTGAACACCCAATGTAA
>probe:Drosophila_2:1632370_at:329:183; Interrogation_Position=564; Antisense; AAAACCGACCGTGCGATGCAGCAGG

Paste this into a BLAST search page for me
TAAGGCAGCCACTATGTCGTATCAATGTCGTATCAACTGTACCGCAACACGAGCCTCGACGAGCTGATTCAGTACAGATTACGCCCGGACTGGCTTTCAAGGCTTTCAAGGTTCTGCTGCAATTCAATGCCCTAAACCAGCGGGTCAAGGTACCGCTTCTGCGACAATGTCTGGATGTCTGGACTCTCATGCTTAACGATTGGAGTTCCGCGAAGTGCACGAGATAAGATCGTGGCCTGCGACGGCAAGATTTTGCTTGACTTGACAGGTTCGTACAAGAGCGGCGAGTTCTGAACACCAGACCCGATCTGAACACCCAATGTAAAAAACCGACCGTGCGATGCAGCAGG

Full Affymetrix probeset data:

Annotations for 1632370_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime