FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632372_at:

>probe:Drosophila_2:1632372_at:579:223; Interrogation_Position=166; Antisense; AAGGATCTGTCTTGGTTGGCGGACT
>probe:Drosophila_2:1632372_at:565:117; Interrogation_Position=197; Antisense; AGCTGCGTCATTTGGTGCTGGACAG
>probe:Drosophila_2:1632372_at:345:111; Interrogation_Position=220; Antisense; AGCAATCGCATGCATGAGGCTCATT
>probe:Drosophila_2:1632372_at:452:17; Interrogation_Position=242; Antisense; ATTTGAGGACACTGACTTGCCCGCT
>probe:Drosophila_2:1632372_at:144:721; Interrogation_Position=258; Antisense; TTGCCCGCTGCCACAATTGGAAGTA
>probe:Drosophila_2:1632372_at:234:113; Interrogation_Position=27; Antisense; AGCACTCATTTCAGTTGCTCACGAG
>probe:Drosophila_2:1632372_at:97:231; Interrogation_Position=298; Antisense; AATGAGTTCAGTGACCTGCCGACGA
>probe:Drosophila_2:1632372_at:728:625; Interrogation_Position=314; Antisense; TGCCGACGACAATGCGACTGATCAG
>probe:Drosophila_2:1632372_at:489:105; Interrogation_Position=337; Antisense; AGAAAGTTCTTTCCCAATCTGCAGT
>probe:Drosophila_2:1632372_at:256:237; Interrogation_Position=352; Antisense; AATCTGCAGTATTTGAGCCTCCATG
>probe:Drosophila_2:1632372_at:178:359; Interrogation_Position=452; Antisense; GCAACTACATTGCACAGTCGCTGAG
>probe:Drosophila_2:1632372_at:594:587; Interrogation_Position=491; Antisense; TGGATCATGGACTGGTTCAACGCAC
>probe:Drosophila_2:1632372_at:562:317; Interrogation_Position=58; Antisense; GCCGGTGAGCTCATTTTGGTGCAAC
>probe:Drosophila_2:1632372_at:254:361; Interrogation_Position=84; Antisense; GAATTTACGAACACTGCCCCAGGAA

Paste this into a BLAST search page for me
AAGGATCTGTCTTGGTTGGCGGACTAGCTGCGTCATTTGGTGCTGGACAGAGCAATCGCATGCATGAGGCTCATTATTTGAGGACACTGACTTGCCCGCTTTGCCCGCTGCCACAATTGGAAGTAAGCACTCATTTCAGTTGCTCACGAGAATGAGTTCAGTGACCTGCCGACGATGCCGACGACAATGCGACTGATCAGAGAAAGTTCTTTCCCAATCTGCAGTAATCTGCAGTATTTGAGCCTCCATGGCAACTACATTGCACAGTCGCTGAGTGGATCATGGACTGGTTCAACGCACGCCGGTGAGCTCATTTTGGTGCAACGAATTTACGAACACTGCCCCAGGAA

Full Affymetrix probeset data:

Annotations for 1632372_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720