Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632373_s_at:

>probe:Drosophila_2:1632373_s_at:714:29; Interrogation_Position=100; Antisense; ATCTTCCAGGACATTAAACCCGCTT
>probe:Drosophila_2:1632373_s_at:472:719; Interrogation_Position=123; Antisense; TTCCCAGCACCATTACTTAGCAGTG
>probe:Drosophila_2:1632373_s_at:492:581; Interrogation_Position=14; Antisense; TGGCGGACGACAACTGCATTTTCTG
>probe:Drosophila_2:1632373_s_at:457:173; Interrogation_Position=153; Antisense; AAAGCACTACGCTAGCCTCAAGGAT
>probe:Drosophila_2:1632373_s_at:500:137; Interrogation_Position=191; Antisense; ACGATTCTTTGGTGCAGCTCATGGA
>probe:Drosophila_2:1632373_s_at:265:617; Interrogation_Position=203; Antisense; TGCAGCTCATGGAGAACGCCCTGAA
>probe:Drosophila_2:1632373_s_at:267:201; Interrogation_Position=217; Antisense; AACGCCCTGAAGGATCTTCTGGTGT
>probe:Drosophila_2:1632373_s_at:109:515; Interrogation_Position=238; Antisense; GTGTCCAAGGGAGTTTCTGTCGATG
>probe:Drosophila_2:1632373_s_at:318:39; Interrogation_Position=281; Antisense; ATCTGCCGCCGTTTATCACGGTGAA
>probe:Drosophila_2:1632373_s_at:241:345; Interrogation_Position=29; Antisense; GCATTTTCTGCCTAATTTCCGATGG
>probe:Drosophila_2:1632373_s_at:221:377; Interrogation_Position=303; Antisense; GAAGCATCTTCACATGCATGCCATT
>probe:Drosophila_2:1632373_s_at:100:131; Interrogation_Position=337; Antisense; ACCCAAATGACCTTCCTATCTAAGA
>probe:Drosophila_2:1632373_s_at:310:215; Interrogation_Position=358; Antisense; AAGATGATCTTTAGACCCTCCGTTT
>probe:Drosophila_2:1632373_s_at:91:547; Interrogation_Position=56; Antisense; GGATCCCCTCCACTGTTTTGGAAGT

Paste this into a BLAST search page for me
ATCTTCCAGGACATTAAACCCGCTTTTCCCAGCACCATTACTTAGCAGTGTGGCGGACGACAACTGCATTTTCTGAAAGCACTACGCTAGCCTCAAGGATACGATTCTTTGGTGCAGCTCATGGATGCAGCTCATGGAGAACGCCCTGAAAACGCCCTGAAGGATCTTCTGGTGTGTGTCCAAGGGAGTTTCTGTCGATGATCTGCCGCCGTTTATCACGGTGAAGCATTTTCTGCCTAATTTCCGATGGGAAGCATCTTCACATGCATGCCATTACCCAAATGACCTTCCTATCTAAGAAAGATGATCTTTAGACCCTCCGTTTGGATCCCCTCCACTGTTTTGGAAGT

Full Affymetrix probeset data:

Annotations for 1632373_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime