Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632374_at:

>probe:Drosophila_2:1632374_at:515:555; Interrogation_Position=1013; Antisense; GGACGCCGTGCGCAAACACATGATC
>probe:Drosophila_2:1632374_at:142:159; Interrogation_Position=1028; Antisense; ACACATGATCGACAAGGGCCACTGC
>probe:Drosophila_2:1632374_at:463:145; Interrogation_Position=1048; Antisense; ACTGCCAGATGCTGCACGAGGGTGT
>probe:Drosophila_2:1632374_at:482:581; Interrogation_Position=1072; Antisense; TGGCGCTGGCCGAGTATGCCGAATA
>probe:Drosophila_2:1632374_at:729:277; Interrogation_Position=1103; Antisense; CTACAGCAGCAGTTATCCGGACAAT
>probe:Drosophila_2:1632374_at:344:665; Interrogation_Position=1242; Antisense; TACAAGCAGCGTCTTCGTCCGGAAC
>probe:Drosophila_2:1632374_at:554:381; Interrogation_Position=1263; Antisense; GAACGCGCCGTCGTCATCAAGAAGT
>probe:Drosophila_2:1632374_at:205:227; Interrogation_Position=1368; Antisense; AAGGCACGCGACATTCATCTGATGA
>probe:Drosophila_2:1632374_at:313:605; Interrogation_Position=1387; Antisense; TGATGAAGCGCGTCCAGTCCAAGTG
>probe:Drosophila_2:1632374_at:384:445; Interrogation_Position=1415; Antisense; GATGAAGCTCGGCTGCAAGGCCAAT
>probe:Drosophila_2:1632374_at:156:111; Interrogation_Position=1450; Antisense; AGCACTATCGTGCACAGGTTCTGAT
>probe:Drosophila_2:1632374_at:408:539; Interrogation_Position=1466; Antisense; GGTTCTGATCTAATCATCGCTTGCT
>probe:Drosophila_2:1632374_at:288:45; Interrogation_Position=1481; Antisense; ATCGCTTGCTTTTCTTTCCAAATGC
>probe:Drosophila_2:1632374_at:173:199; Interrogation_Position=984; Antisense; AACGATCGCGGCAAGACCTTCTATT

Paste this into a BLAST search page for me
GGACGCCGTGCGCAAACACATGATCACACATGATCGACAAGGGCCACTGCACTGCCAGATGCTGCACGAGGGTGTTGGCGCTGGCCGAGTATGCCGAATACTACAGCAGCAGTTATCCGGACAATTACAAGCAGCGTCTTCGTCCGGAACGAACGCGCCGTCGTCATCAAGAAGTAAGGCACGCGACATTCATCTGATGATGATGAAGCGCGTCCAGTCCAAGTGGATGAAGCTCGGCTGCAAGGCCAATAGCACTATCGTGCACAGGTTCTGATGGTTCTGATCTAATCATCGCTTGCTATCGCTTGCTTTTCTTTCCAAATGCAACGATCGCGGCAAGACCTTCTATT

Full Affymetrix probeset data:

Annotations for 1632374_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime