FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632376_at:

>probe:Drosophila_2:1632376_at:671:159; Interrogation_Position=1149; Antisense; ACAACATTATGTTCCGCTCTGAGCC
>probe:Drosophila_2:1632376_at:338:77; Interrogation_Position=1176; Antisense; AGGAGGTGATCTTCTTCGACCTGCA
>probe:Drosophila_2:1632376_at:401:359; Interrogation_Position=1209; Antisense; GCAAGTCGTCGCCTATTTTTGACAT
>probe:Drosophila_2:1632376_at:6:725; Interrogation_Position=1227; Antisense; TTGACATTCTCCACTTCATTTACAC
>probe:Drosophila_2:1632376_at:373:371; Interrogation_Position=1260; Antisense; GAAGGCCACTCAGGGATGTGCACAC
>probe:Drosophila_2:1632376_at:207:333; Interrogation_Position=1339; Antisense; GCTGGAGGATACAACCGCTGCCGAA
>probe:Drosophila_2:1632376_at:601:681; Interrogation_Position=1377; Antisense; TATGTGAAGCATTCTCCTTGCAGCG
>probe:Drosophila_2:1632376_at:536:353; Interrogation_Position=1396; Antisense; GCAGCGCCTCAGTTCGGATTATGTT
>probe:Drosophila_2:1632376_at:5:535; Interrogation_Position=1426; Antisense; GGTGCATTATGGACTGGCTATCGGC
>probe:Drosophila_2:1632376_at:541:569; Interrogation_Position=1441; Antisense; GGCTATCGGCATGTGGATCCTTCCA
>probe:Drosophila_2:1632376_at:508:427; Interrogation_Position=1535; Antisense; GAGATCAAGTGCACCCAGATGCTCA
>probe:Drosophila_2:1632376_at:627:97; Interrogation_Position=1551; Antisense; AGATGCTCACTTCCGAGTACCATAT
>probe:Drosophila_2:1632376_at:362:513; Interrogation_Position=1592; Antisense; GTGATGGAATTCTACGAGCTCGGCT
>probe:Drosophila_2:1632376_at:565:417; Interrogation_Position=1607; Antisense; GAGCTCGGCTATCTTCAGATGCAAA

Paste this into a BLAST search page for me
ACAACATTATGTTCCGCTCTGAGCCAGGAGGTGATCTTCTTCGACCTGCAGCAAGTCGTCGCCTATTTTTGACATTTGACATTCTCCACTTCATTTACACGAAGGCCACTCAGGGATGTGCACACGCTGGAGGATACAACCGCTGCCGAATATGTGAAGCATTCTCCTTGCAGCGGCAGCGCCTCAGTTCGGATTATGTTGGTGCATTATGGACTGGCTATCGGCGGCTATCGGCATGTGGATCCTTCCAGAGATCAAGTGCACCCAGATGCTCAAGATGCTCACTTCCGAGTACCATATGTGATGGAATTCTACGAGCTCGGCTGAGCTCGGCTATCTTCAGATGCAAA

Full Affymetrix probeset data:

Annotations for 1632376_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720