Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632377_at:

>probe:Drosophila_2:1632377_at:91:661; Interrogation_Position=1750; Antisense; TAAAACTACCAAAGGCCGAGCTGCC
>probe:Drosophila_2:1632377_at:285:263; Interrogation_Position=1799; Antisense; CAGCTTCGTGGTGGTGCATGTACTC
>probe:Drosophila_2:1632377_at:358:59; Interrogation_Position=1816; Antisense; ATGTACTCGTCCACCTGATATTCTC
>probe:Drosophila_2:1632377_at:432:605; Interrogation_Position=1831; Antisense; TGATATTCTCCATTGGCGGCATGGC
>probe:Drosophila_2:1632377_at:211:263; Interrogation_Position=1875; Antisense; CAGCGGGCGAACACTTTCCAAATGG
>probe:Drosophila_2:1632377_at:47:231; Interrogation_Position=1895; Antisense; AATGGGCGACATGTCCCATCATCAG
>probe:Drosophila_2:1632377_at:237:37; Interrogation_Position=1912; Antisense; ATCATCAGCAGCACGCCATGCGGAA
>probe:Drosophila_2:1632377_at:620:91; Interrogation_Position=2000; Antisense; AGTTTACGGCGTGGTGCTGATTCTC
>probe:Drosophila_2:1632377_at:218:463; Interrogation_Position=2018; Antisense; GATTCTCTTCGTGACGGTGCTGATC
>probe:Drosophila_2:1632377_at:109:245; Interrogation_Position=2098; Antisense; AATTCGGATGTCCTGTAACCTGTCC
>probe:Drosophila_2:1632377_at:66:147; Interrogation_Position=2132; Antisense; ACTCGTGTCAGTTTTGTGTGCTCAT
>probe:Drosophila_2:1632377_at:325:721; Interrogation_Position=2145; Antisense; TTGTGTGCTCATTGTTTAACCCCTT
>probe:Drosophila_2:1632377_at:411:47; Interrogation_Position=2208; Antisense; ATCCTTTTTCCATTCAGCTTTGTGT
>probe:Drosophila_2:1632377_at:205:575; Interrogation_Position=2266; Antisense; GGCGGAGCGTTCAGTACATGTTATA

Paste this into a BLAST search page for me
TAAAACTACCAAAGGCCGAGCTGCCCAGCTTCGTGGTGGTGCATGTACTCATGTACTCGTCCACCTGATATTCTCTGATATTCTCCATTGGCGGCATGGCCAGCGGGCGAACACTTTCCAAATGGAATGGGCGACATGTCCCATCATCAGATCATCAGCAGCACGCCATGCGGAAAGTTTACGGCGTGGTGCTGATTCTCGATTCTCTTCGTGACGGTGCTGATCAATTCGGATGTCCTGTAACCTGTCCACTCGTGTCAGTTTTGTGTGCTCATTTGTGTGCTCATTGTTTAACCCCTTATCCTTTTTCCATTCAGCTTTGTGTGGCGGAGCGTTCAGTACATGTTATA

Full Affymetrix probeset data:

Annotations for 1632377_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime