Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632378_at:

>probe:Drosophila_2:1632378_at:503:299; Interrogation_Position=4799; Antisense; CCCACCACTACAAGGGTCTGCAGAT
>probe:Drosophila_2:1632378_at:163:311; Interrogation_Position=4803; Antisense; CCACTACAAGGGTCTGCAGATGCAG
>probe:Drosophila_2:1632378_at:370:497; Interrogation_Position=4814; Antisense; GTCTGCAGATGCAGAGGCCCACCTT
>probe:Drosophila_2:1632378_at:263:617; Interrogation_Position=4817; Antisense; TGCAGATGCAGAGGCCCACCTTGTT
>probe:Drosophila_2:1632378_at:10:447; Interrogation_Position=4821; Antisense; GATGCAGAGGCCCACCTTGTTGCAA
>probe:Drosophila_2:1632378_at:314:351; Interrogation_Position=4824; Antisense; GCAGAGGCCCACCTTGTTGCAAAGT
>probe:Drosophila_2:1632378_at:131:99; Interrogation_Position=4826; Antisense; AGAGGCCCACCTTGTTGCAAAGTCC
>probe:Drosophila_2:1632378_at:316:69; Interrogation_Position=4828; Antisense; AGGCCCACCTTGTTGCAAAGTCCGT
>probe:Drosophila_2:1632378_at:393:133; Interrogation_Position=4833; Antisense; CACCTTGTTGCAAAGTCCGTCCCGT
>probe:Drosophila_2:1632378_at:713:719; Interrogation_Position=4837; Antisense; TTGTTGCAAAGTCCGTCCCGTCCAC
>probe:Drosophila_2:1632378_at:282:505; Interrogation_Position=4856; Antisense; GTCCACCGGCTATCTGGCAATCGCT
>probe:Drosophila_2:1632378_at:576:305; Interrogation_Position=4861; Antisense; CCGGCTATCTGGCAATCGCTGCGAA
>probe:Drosophila_2:1632378_at:511:571; Interrogation_Position=4863; Antisense; GGCTATCTGGCAATCGCTGCGAAGT
>probe:Drosophila_2:1632378_at:511:341; Interrogation_Position=4864; Antisense; GCTATCTGGCAATCGCTGCGAAGTC

Paste this into a BLAST search page for me
CCCACCACTACAAGGGTCTGCAGATCCACTACAAGGGTCTGCAGATGCAGGTCTGCAGATGCAGAGGCCCACCTTTGCAGATGCAGAGGCCCACCTTGTTGATGCAGAGGCCCACCTTGTTGCAAGCAGAGGCCCACCTTGTTGCAAAGTAGAGGCCCACCTTGTTGCAAAGTCCAGGCCCACCTTGTTGCAAAGTCCGTCACCTTGTTGCAAAGTCCGTCCCGTTTGTTGCAAAGTCCGTCCCGTCCACGTCCACCGGCTATCTGGCAATCGCTCCGGCTATCTGGCAATCGCTGCGAAGGCTATCTGGCAATCGCTGCGAAGTGCTATCTGGCAATCGCTGCGAAGTC

Full Affymetrix probeset data:

Annotations for 1632378_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime