Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632380_at:

>probe:Drosophila_2:1632380_at:590:327; Interrogation_Position=4934; Antisense; GCGATTGTGACAACGTGACTTCAAT
>probe:Drosophila_2:1632380_at:168:243; Interrogation_Position=4999; Antisense; AATAGTCACACTTTCAGCTTTTCCT
>probe:Drosophila_2:1632380_at:369:377; Interrogation_Position=5029; Antisense; GAAGCTGAGATTCTTGGTTCATTGT
>probe:Drosophila_2:1632380_at:430:473; Interrogation_Position=5045; Antisense; GTTCATTGTAAGACAAGACGCCCGA
>probe:Drosophila_2:1632380_at:655:103; Interrogation_Position=5060; Antisense; AGACGCCCGATGAAGATCACTGCAA
>probe:Drosophila_2:1632380_at:107:455; Interrogation_Position=5074; Antisense; GATCACTGCAACACAGACACATGTC
>probe:Drosophila_2:1632380_at:460:119; Interrogation_Position=5126; Antisense; AGCTGAAATTGACCCTCAGGTCCCA
>probe:Drosophila_2:1632380_at:321:649; Interrogation_Position=5141; Antisense; TCAGGTCCCACGAAACACACGAAAA
>probe:Drosophila_2:1632380_at:199:151; Interrogation_Position=5157; Antisense; ACACGAAAACTCACTCACCTGCGGT
>probe:Drosophila_2:1632380_at:446:261; Interrogation_Position=5172; Antisense; CACCTGCGGTTCTTACTGATTAGTC
>probe:Drosophila_2:1632380_at:666:143; Interrogation_Position=5186; Antisense; ACTGATTAGTCACTTCGAGCTCTCA
>probe:Drosophila_2:1632380_at:404:317; Interrogation_Position=5276; Antisense; GCGCCTTGATGGATTCGGCAGAGTT
>probe:Drosophila_2:1632380_at:545:143; Interrogation_Position=5355; Antisense; ACTTTATGCAGTAACCGTAACGACA
>probe:Drosophila_2:1632380_at:260:15; Interrogation_Position=5444; Antisense; ATTTTATTCGACGAGAAATCGCTAG

Paste this into a BLAST search page for me
GCGATTGTGACAACGTGACTTCAATAATAGTCACACTTTCAGCTTTTCCTGAAGCTGAGATTCTTGGTTCATTGTGTTCATTGTAAGACAAGACGCCCGAAGACGCCCGATGAAGATCACTGCAAGATCACTGCAACACAGACACATGTCAGCTGAAATTGACCCTCAGGTCCCATCAGGTCCCACGAAACACACGAAAAACACGAAAACTCACTCACCTGCGGTCACCTGCGGTTCTTACTGATTAGTCACTGATTAGTCACTTCGAGCTCTCAGCGCCTTGATGGATTCGGCAGAGTTACTTTATGCAGTAACCGTAACGACAATTTTATTCGACGAGAAATCGCTAG

Full Affymetrix probeset data:

Annotations for 1632380_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime