FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632381_at:

>probe:Drosophila_2:1632381_at:683:227; Interrogation_Position=4348; Antisense; AATGGCTACGTAACGCCGCAGGATC
>probe:Drosophila_2:1632381_at:605:545; Interrogation_Position=4368; Antisense; GGATCTGAACGCCATGGCCCACAAT
>probe:Drosophila_2:1632381_at:193:565; Interrogation_Position=4394; Antisense; GGCACGTCCTCTAAGATACCGGAGC
>probe:Drosophila_2:1632381_at:338:417; Interrogation_Position=4415; Antisense; GAGCGCTCATCATTTATGCACGGGT
>probe:Drosophila_2:1632381_at:436:597; Interrogation_Position=4439; Antisense; TGTGCATCATTTTATCGTTTCCTCG
>probe:Drosophila_2:1632381_at:37:283; Interrogation_Position=4460; Antisense; CTCGCGTTCGCATCGATAATTCATC
>probe:Drosophila_2:1632381_at:307:655; Interrogation_Position=4476; Antisense; TAATTCATCAACTCATCTTCAGCCG
>probe:Drosophila_2:1632381_at:76:25; Interrogation_Position=4502; Antisense; ATATCCTTCCAACGCCATGATCTGG
>probe:Drosophila_2:1632381_at:264:677; Interrogation_Position=4611; Antisense; TAGAAACCACTGTCGGGCAGCTGTT
>probe:Drosophila_2:1632381_at:23:389; Interrogation_Position=4649; Antisense; GAAAACTCCTCGGACGAATGTAGTT
>probe:Drosophila_2:1632381_at:392:481; Interrogation_Position=4694; Antisense; GTATTCTTTGCGATGCGTGTGAGGC
>probe:Drosophila_2:1632381_at:45:669; Interrogation_Position=4762; Antisense; TACTGTACACTTACTTACCCACTTA
>probe:Drosophila_2:1632381_at:47:135; Interrogation_Position=4794; Antisense; ACGCGTCGAGCGGATCGAGCTTATA
>probe:Drosophila_2:1632381_at:394:669; Interrogation_Position=4842; Antisense; TACGCACATCGCTGTATTTCAATAT

Paste this into a BLAST search page for me
AATGGCTACGTAACGCCGCAGGATCGGATCTGAACGCCATGGCCCACAATGGCACGTCCTCTAAGATACCGGAGCGAGCGCTCATCATTTATGCACGGGTTGTGCATCATTTTATCGTTTCCTCGCTCGCGTTCGCATCGATAATTCATCTAATTCATCAACTCATCTTCAGCCGATATCCTTCCAACGCCATGATCTGGTAGAAACCACTGTCGGGCAGCTGTTGAAAACTCCTCGGACGAATGTAGTTGTATTCTTTGCGATGCGTGTGAGGCTACTGTACACTTACTTACCCACTTAACGCGTCGAGCGGATCGAGCTTATATACGCACATCGCTGTATTTCAATAT

Full Affymetrix probeset data:

Annotations for 1632381_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720