FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632383_at:

>probe:Drosophila_2:1632383_at:588:205; Interrogation_Position=1010; Antisense; AAGCGTCTTGGGTTCAGTACGTCAC
>probe:Drosophila_2:1632383_at:449:367; Interrogation_Position=1057; Antisense; GAAGCAAACCGTGTTCTACCTCGAT
>probe:Drosophila_2:1632383_at:555:673; Interrogation_Position=1073; Antisense; TACCTCGATGACCACATGACGGCAA
>probe:Drosophila_2:1632383_at:337:585; Interrogation_Position=1117; Antisense; TGGCACGTTCCAGATGAAGCCCAAC
>probe:Drosophila_2:1632383_at:502:561; Interrogation_Position=1146; Antisense; GGAACAACCGTGACCTGGACTTCGT
>probe:Drosophila_2:1632383_at:358:75; Interrogation_Position=1209; Antisense; AGGAGTCGAACACATACCGCATGCG
>probe:Drosophila_2:1632383_at:551:657; Interrogation_Position=1247; Antisense; TAACCAATCCGATCTGCCATTTGGG
>probe:Drosophila_2:1632383_at:343:603; Interrogation_Position=1355; Antisense; TGTTGCGTCTTCTCCTAAGTTTAAA
>probe:Drosophila_2:1632383_at:534:243; Interrogation_Position=1402; Antisense; AATATTTTACACTCGTGCGCCTGTT
>probe:Drosophila_2:1632383_at:110:115; Interrogation_Position=1465; Antisense; AGCAGCACGTCAATTCTCACATAAT
>probe:Drosophila_2:1632383_at:283:93; Interrogation_Position=930; Antisense; AGTTCAGCCTATGCATCAAGCGCAA
>probe:Drosophila_2:1632383_at:5:207; Interrogation_Position=947; Antisense; AAGCGCAACGACTTCGTGCAGGCAT
>probe:Drosophila_2:1632383_at:574:507; Interrogation_Position=962; Antisense; GTGCAGGCATTAGTCACCTACTTTA
>probe:Drosophila_2:1632383_at:208:101; Interrogation_Position=991; Antisense; AGAGTTCACCAAGTGCCACAAGCGT

Paste this into a BLAST search page for me
AAGCGTCTTGGGTTCAGTACGTCACGAAGCAAACCGTGTTCTACCTCGATTACCTCGATGACCACATGACGGCAATGGCACGTTCCAGATGAAGCCCAACGGAACAACCGTGACCTGGACTTCGTAGGAGTCGAACACATACCGCATGCGTAACCAATCCGATCTGCCATTTGGGTGTTGCGTCTTCTCCTAAGTTTAAAAATATTTTACACTCGTGCGCCTGTTAGCAGCACGTCAATTCTCACATAATAGTTCAGCCTATGCATCAAGCGCAAAAGCGCAACGACTTCGTGCAGGCATGTGCAGGCATTAGTCACCTACTTTAAGAGTTCACCAAGTGCCACAAGCGT

Full Affymetrix probeset data:

Annotations for 1632383_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720