FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632384_at:

>probe:Drosophila_2:1632384_at:539:437; Interrogation_Position=151; Antisense; GAGGACGACGAGCTGACCCTGCCAC
>probe:Drosophila_2:1632384_at:384:579; Interrogation_Position=225; Antisense; GGCCAACGAGAGTCGCGAGCTGATA
>probe:Drosophila_2:1632384_at:151:419; Interrogation_Position=241; Antisense; GAGCTGATACTCAACTGCTGCTCAG
>probe:Drosophila_2:1632384_at:501:193; Interrogation_Position=253; Antisense; AACTGCTGCTCAGAGTTCATTCATC
>probe:Drosophila_2:1632384_at:705:471; Interrogation_Position=267; Antisense; GTTCATTCATCTGATCAGTTCGGAG
>probe:Drosophila_2:1632384_at:20:291; Interrogation_Position=287; Antisense; CGGAGGCCAACGAGGTGTGCAACAT
>probe:Drosophila_2:1632384_at:635:661; Interrogation_Position=329; Antisense; TAAACGCAGAGCACGTCCTGGAGGC
>probe:Drosophila_2:1632384_at:588:379; Interrogation_Position=358; Antisense; GAACGCTTGGGTTTTCACGACTACA
>probe:Drosophila_2:1632384_at:263:161; Interrogation_Position=384; Antisense; ACAAGAGGCGGAGGCCGTTCTGCAC
>probe:Drosophila_2:1632384_at:134:71; Interrogation_Position=395; Antisense; AGGCCGTTCTGCACGACTGCAAGGA
>probe:Drosophila_2:1632384_at:46:103; Interrogation_Position=443; Antisense; AGAGCACGCGCCTAGAGAACCTGGG
>probe:Drosophila_2:1632384_at:572:545; Interrogation_Position=554; Antisense; GGATGAGCATGCAAGCGGCAGCAAT
>probe:Drosophila_2:1632384_at:164:293; Interrogation_Position=609; Antisense; CGTTGCCAGCAAGCCAAGTGAGGAT
>probe:Drosophila_2:1632384_at:648:55; Interrogation_Position=644; Antisense; ATGACGACGACGACTACTAGTAGGA

Paste this into a BLAST search page for me
GAGGACGACGAGCTGACCCTGCCACGGCCAACGAGAGTCGCGAGCTGATAGAGCTGATACTCAACTGCTGCTCAGAACTGCTGCTCAGAGTTCATTCATCGTTCATTCATCTGATCAGTTCGGAGCGGAGGCCAACGAGGTGTGCAACATTAAACGCAGAGCACGTCCTGGAGGCGAACGCTTGGGTTTTCACGACTACAACAAGAGGCGGAGGCCGTTCTGCACAGGCCGTTCTGCACGACTGCAAGGAAGAGCACGCGCCTAGAGAACCTGGGGGATGAGCATGCAAGCGGCAGCAATCGTTGCCAGCAAGCCAAGTGAGGATATGACGACGACGACTACTAGTAGGA

Full Affymetrix probeset data:

Annotations for 1632384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720