Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632385_at:

>probe:Drosophila_2:1632385_at:267:113; Interrogation_Position=6946; Antisense; AGCAGCGCTACGAGGTGACCCTAAG
>probe:Drosophila_2:1632385_at:342:483; Interrogation_Position=6960; Antisense; GTGACCCTAAGGTGCCTAGTTCAGA
>probe:Drosophila_2:1632385_at:180:473; Interrogation_Position=6978; Antisense; GTTCAGAACCAAGGATCACGTACAA
>probe:Drosophila_2:1632385_at:594:489; Interrogation_Position=6997; Antisense; GTACAACCAAAACTTCTCTTGCGCA
>probe:Drosophila_2:1632385_at:313:719; Interrogation_Position=7015; Antisense; TTGCGCACGCATTTATGGCTCTAGA
>probe:Drosophila_2:1632385_at:677:135; Interrogation_Position=7021; Antisense; ACGCATTTATGGCTCTAGATACGAA
>probe:Drosophila_2:1632385_at:128:395; Interrogation_Position=7068; Antisense; GAAAGGCGAAGCATGTACATCTAAT
>probe:Drosophila_2:1632385_at:136:359; Interrogation_Position=7173; Antisense; GCAAAATGGGAACCTCGTCTAAAAG
>probe:Drosophila_2:1632385_at:46:243; Interrogation_Position=7214; Antisense; AATACCAGACACAAGCTCTAGTTAA
>probe:Drosophila_2:1632385_at:262:245; Interrogation_Position=7385; Antisense; AATTATGCGTTAAGTGCTGGCCGTT
>probe:Drosophila_2:1632385_at:164:333; Interrogation_Position=7400; Antisense; GCTGGCCGTTTCGAGGTGTTGTTAA
>probe:Drosophila_2:1632385_at:589:661; Interrogation_Position=7468; Antisense; TAACATTTGGAGAGGCGTTGGCAAC
>probe:Drosophila_2:1632385_at:387:465; Interrogation_Position=7484; Antisense; GTTGGCAACGGCAGCAGTTGGCTAA
>probe:Drosophila_2:1632385_at:17:467; Interrogation_Position=7500; Antisense; GTTGGCTAAGCTCTAGATATAACGA

Paste this into a BLAST search page for me
AGCAGCGCTACGAGGTGACCCTAAGGTGACCCTAAGGTGCCTAGTTCAGAGTTCAGAACCAAGGATCACGTACAAGTACAACCAAAACTTCTCTTGCGCATTGCGCACGCATTTATGGCTCTAGAACGCATTTATGGCTCTAGATACGAAGAAAGGCGAAGCATGTACATCTAATGCAAAATGGGAACCTCGTCTAAAAGAATACCAGACACAAGCTCTAGTTAAAATTATGCGTTAAGTGCTGGCCGTTGCTGGCCGTTTCGAGGTGTTGTTAATAACATTTGGAGAGGCGTTGGCAACGTTGGCAACGGCAGCAGTTGGCTAAGTTGGCTAAGCTCTAGATATAACGA

Full Affymetrix probeset data:

Annotations for 1632385_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime