FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632387_at:

>probe:Drosophila_2:1632387_at:633:49; Interrogation_Position=1014; Antisense; ATGCCTGTTTAGTTCGCTTACTGGA
>probe:Drosophila_2:1632387_at:355:217; Interrogation_Position=1073; Antisense; AAGTTTCACCTGATTTTTGGCGAAG
>probe:Drosophila_2:1632387_at:293:429; Interrogation_Position=1109; Antisense; GAGTTCGCAAACCAGTTATCCAGCC
>probe:Drosophila_2:1632387_at:643:475; Interrogation_Position=1123; Antisense; GTTATCCAGCCCGTCAATTGATTTA
>probe:Drosophila_2:1632387_at:325:585; Interrogation_Position=1149; Antisense; TGGACGAAGTTCTGCTGGCCAGCTG
>probe:Drosophila_2:1632387_at:9:483; Interrogation_Position=1182; Antisense; GTATTCGCCCATGGATTGTACGTCA
>probe:Drosophila_2:1632387_at:556:435; Interrogation_Position=1223; Antisense; GAGGAGGGCCTTATCGCCAATCGAT
>probe:Drosophila_2:1632387_at:269:577; Interrogation_Position=1276; Antisense; GGCGCACTCCATTGTCATGGTCAAT
>probe:Drosophila_2:1632387_at:486:65; Interrogation_Position=1292; Antisense; ATGGTCAATCCATATTGCTCCGAGC
>probe:Drosophila_2:1632387_at:318:603; Interrogation_Position=1333; Antisense; TGTTGAGCACTTGTTCTGCCTTAGA
>probe:Drosophila_2:1632387_at:664:623; Interrogation_Position=1395; Antisense; TGCCACCCTTGGAGGTCTCAAAATT
>probe:Drosophila_2:1632387_at:94:333; Interrogation_Position=830; Antisense; GCTGTTACTGACGATCCGCAGATCT
>probe:Drosophila_2:1632387_at:529:181; Interrogation_Position=894; Antisense; AAAAAATTGAGCATCCACCCACATC
>probe:Drosophila_2:1632387_at:481:99; Interrogation_Position=999; Antisense; AGAGGAGGCGTCTCAATGCCTGTTT

Paste this into a BLAST search page for me
ATGCCTGTTTAGTTCGCTTACTGGAAAGTTTCACCTGATTTTTGGCGAAGGAGTTCGCAAACCAGTTATCCAGCCGTTATCCAGCCCGTCAATTGATTTATGGACGAAGTTCTGCTGGCCAGCTGGTATTCGCCCATGGATTGTACGTCAGAGGAGGGCCTTATCGCCAATCGATGGCGCACTCCATTGTCATGGTCAATATGGTCAATCCATATTGCTCCGAGCTGTTGAGCACTTGTTCTGCCTTAGATGCCACCCTTGGAGGTCTCAAAATTGCTGTTACTGACGATCCGCAGATCTAAAAAATTGAGCATCCACCCACATCAGAGGAGGCGTCTCAATGCCTGTTT

Full Affymetrix probeset data:

Annotations for 1632387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720