FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632388_at:

>probe:Drosophila_2:1632388_at:682:691; Interrogation_Position=112; Antisense; TTTGACGAGGTCTACAACCAGAGTA
>probe:Drosophila_2:1632388_at:471:101; Interrogation_Position=131; Antisense; AGAGTAGCCCCACCAATTGCACTGT
>probe:Drosophila_2:1632388_at:476:247; Interrogation_Position=145; Antisense; AATTGCACTGTCTACTGTGGCGGCA
>probe:Drosophila_2:1632388_at:193:643; Interrogation_Position=182; Antisense; TCTCTGGCTTCCTCAACGAGGAGAT
>probe:Drosophila_2:1632388_at:452:461; Interrogation_Position=204; Antisense; GATTCTGCAGAAGACCTTTTCGCCG
>probe:Drosophila_2:1632388_at:398:413; Interrogation_Position=216; Antisense; GACCTTTTCGCCGTATGGCACAATA
>probe:Drosophila_2:1632388_at:407:223; Interrogation_Position=266; Antisense; AAGGATACGCATTCGTGCGTTTCTC
>probe:Drosophila_2:1632388_at:307:129; Interrogation_Position=344; Antisense; ACCAGCAGCCGGTGAAGTGTGCATG
>probe:Drosophila_2:1632388_at:191:457; Interrogation_Position=42; Antisense; GATACGCACAAATTGGGCCACACGA
>probe:Drosophila_2:1632388_at:478:113; Interrogation_Position=482; Antisense; AGCAGGTGGCCGGATACTGGTACCC
>probe:Drosophila_2:1632388_at:352:713; Interrogation_Position=548; Antisense; TTCAGCCCGGACAGTTCCTGCAGGG
>probe:Drosophila_2:1632388_at:178:619; Interrogation_Position=566; Antisense; TGCAGGGCATGCAGGGATTCACCTA
>probe:Drosophila_2:1632388_at:575:81; Interrogation_Position=578; Antisense; AGGGATTCACCTACGGTCAATTCGC
>probe:Drosophila_2:1632388_at:200:289; Interrogation_Position=603; Antisense; CGGCTACCAGCAGGCGGGATACATG

Paste this into a BLAST search page for me
TTTGACGAGGTCTACAACCAGAGTAAGAGTAGCCCCACCAATTGCACTGTAATTGCACTGTCTACTGTGGCGGCATCTCTGGCTTCCTCAACGAGGAGATGATTCTGCAGAAGACCTTTTCGCCGGACCTTTTCGCCGTATGGCACAATAAAGGATACGCATTCGTGCGTTTCTCACCAGCAGCCGGTGAAGTGTGCATGGATACGCACAAATTGGGCCACACGAAGCAGGTGGCCGGATACTGGTACCCTTCAGCCCGGACAGTTCCTGCAGGGTGCAGGGCATGCAGGGATTCACCTAAGGGATTCACCTACGGTCAATTCGCCGGCTACCAGCAGGCGGGATACATG

Full Affymetrix probeset data:

Annotations for 1632388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720