FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632389_at:

>probe:Drosophila_2:1632389_at:521:313; Interrogation_Position=138; Antisense; GCCAGGGATTGTGTTTGGGCACCAA
>probe:Drosophila_2:1632389_at:703:149; Interrogation_Position=168; Antisense; ACATTGATCCGAACGTGTCCGGCAT
>probe:Drosophila_2:1632389_at:374:359; Interrogation_Position=248; Antisense; GCAACGATTTGCCTTTACAGCGGAA
>probe:Drosophila_2:1632389_at:295:389; Interrogation_Position=270; Antisense; GAAACAAACGCTGTGTCATCCAGAA
>probe:Drosophila_2:1632389_at:688:405; Interrogation_Position=296; Antisense; GACGGCGAGATCACAGGCGTTATCT
>probe:Drosophila_2:1632389_at:711:475; Interrogation_Position=314; Antisense; GTTATCTTCAAGCAGCCGACGGGTA
>probe:Drosophila_2:1632389_at:77:653; Interrogation_Position=379; Antisense; TCAATCGCAACTCTCAGGCCAAATA
>probe:Drosophila_2:1632389_at:658:29; Interrogation_Position=445; Antisense; ATACTTATATCTTCCAAGTCGCGCC
>probe:Drosophila_2:1632389_at:103:433; Interrogation_Position=489; Antisense; GATGGTAGCGCCTGTTACATTTGTC
>probe:Drosophila_2:1632389_at:599:707; Interrogation_Position=503; Antisense; TTACATTTGTCGCTCATTCTAACCG
>probe:Drosophila_2:1632389_at:564:115; Interrogation_Position=543; Antisense; AGCATTGTTTTGTACGACTCGCATA
>probe:Drosophila_2:1632389_at:431:113; Interrogation_Position=594; Antisense; AGCACTGCTGTTACTTGATCTTGTT
>probe:Drosophila_2:1632389_at:127:481; Interrogation_Position=616; Antisense; GTTTGTCTTAACCAGTCTAGCGTCA
>probe:Drosophila_2:1632389_at:685:403; Interrogation_Position=657; Antisense; GACTTTGTACGATTAAGCCCCAGAA

Paste this into a BLAST search page for me
GCCAGGGATTGTGTTTGGGCACCAAACATTGATCCGAACGTGTCCGGCATGCAACGATTTGCCTTTACAGCGGAAGAAACAAACGCTGTGTCATCCAGAAGACGGCGAGATCACAGGCGTTATCTGTTATCTTCAAGCAGCCGACGGGTATCAATCGCAACTCTCAGGCCAAATAATACTTATATCTTCCAAGTCGCGCCGATGGTAGCGCCTGTTACATTTGTCTTACATTTGTCGCTCATTCTAACCGAGCATTGTTTTGTACGACTCGCATAAGCACTGCTGTTACTTGATCTTGTTGTTTGTCTTAACCAGTCTAGCGTCAGACTTTGTACGATTAAGCCCCAGAA

Full Affymetrix probeset data:

Annotations for 1632389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720