FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632390_at:

>probe:Drosophila_2:1632390_at:157:221; Interrogation_Position=101; Antisense; AAGTGTCAAGATGTCCCTGGTTTCA
>probe:Drosophila_2:1632390_at:374:61; Interrogation_Position=111; Antisense; ATGTCCCTGGTTTCAGATGAGGAGT
>probe:Drosophila_2:1632390_at:211:551; Interrogation_Position=140; Antisense; GGAGTACAAGTCCAAGTTCGACAAG
>probe:Drosophila_2:1632390_at:193:545; Interrogation_Position=182; Antisense; GGATCTGATGCGTCGTAGAATCTAC
>probe:Drosophila_2:1632390_at:114:317; Interrogation_Position=207; Antisense; GCCGAGTCCAAAGCCCGGATTGAGG
>probe:Drosophila_2:1632390_at:498:23; Interrogation_Position=26; Antisense; ATATGTTGTGACTCAGTGCGAAACC
>probe:Drosophila_2:1632390_at:114:21; Interrogation_Position=286; Antisense; ATTTGGCTGATCTCACGCCTGAGGA
>probe:Drosophila_2:1632390_at:326:317; Interrogation_Position=302; Antisense; GCCTGAGGAATTTGCCCAGCGTTGT
>probe:Drosophila_2:1632390_at:709:533; Interrogation_Position=335; Antisense; GGTGCCGCCAAATTAACAGAATCTC
>probe:Drosophila_2:1632390_at:303:367; Interrogation_Position=353; Antisense; GAATCTCAAGTGAATCTCATTTTAA
>probe:Drosophila_2:1632390_at:308:399; Interrogation_Position=394; Antisense; GACACTAATCTCTCTGTAATTCTAT
>probe:Drosophila_2:1632390_at:719:489; Interrogation_Position=41; Antisense; GTGCGAAACCGTGATAAAACCTGAG
>probe:Drosophila_2:1632390_at:724:489; Interrogation_Position=69; Antisense; TGAAACGAAATTTAGTCGGTCACCA
>probe:Drosophila_2:1632390_at:360:501; Interrogation_Position=83; Antisense; GTCGGTCACCAAAATTACAAGTGTC

Paste this into a BLAST search page for me
AAGTGTCAAGATGTCCCTGGTTTCAATGTCCCTGGTTTCAGATGAGGAGTGGAGTACAAGTCCAAGTTCGACAAGGGATCTGATGCGTCGTAGAATCTACGCCGAGTCCAAAGCCCGGATTGAGGATATGTTGTGACTCAGTGCGAAACCATTTGGCTGATCTCACGCCTGAGGAGCCTGAGGAATTTGCCCAGCGTTGTGGTGCCGCCAAATTAACAGAATCTCGAATCTCAAGTGAATCTCATTTTAAGACACTAATCTCTCTGTAATTCTATGTGCGAAACCGTGATAAAACCTGAGTGAAACGAAATTTAGTCGGTCACCAGTCGGTCACCAAAATTACAAGTGTC

Full Affymetrix probeset data:

Annotations for 1632390_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720