Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632391_at:

>probe:Drosophila_2:1632391_at:250:149; Interrogation_Position=3051; Antisense; ACATTGCCGGGCAGGAACTTCCATG
>probe:Drosophila_2:1632391_at:632:71; Interrogation_Position=3063; Antisense; AGGAACTTCCATGTCGAATCGGTTG
>probe:Drosophila_2:1632391_at:462:293; Interrogation_Position=3077; Antisense; CGAATCGGTTGGTTTCCAAGTCGCA
>probe:Drosophila_2:1632391_at:4:661; Interrogation_Position=3117; Antisense; TACAACTCGAGTTTCCTGTTAAGTT
>probe:Drosophila_2:1632391_at:537:677; Interrogation_Position=3152; Antisense; TAGTTTCTAGGAATGGCTGCCGTCC
>probe:Drosophila_2:1632391_at:545:283; Interrogation_Position=3168; Antisense; CTGCCGTCCGCAATTGTTGATTTAT
>probe:Drosophila_2:1632391_at:499:691; Interrogation_Position=3228; Antisense; TTTGTTCTCAAACTCAAGTGCTTAT
>probe:Drosophila_2:1632391_at:200:85; Interrogation_Position=3244; Antisense; AGTGCTTATACTTTGATTCCTATTA
>probe:Drosophila_2:1632391_at:599:689; Interrogation_Position=3264; Antisense; TATTAGTTGTTCACTCTATCCTCCT
>probe:Drosophila_2:1632391_at:277:47; Interrogation_Position=3281; Antisense; ATCCTCCTGTCGTTCTAATGTTCAA
>probe:Drosophila_2:1632391_at:643:407; Interrogation_Position=3356; Antisense; GACGTTTTGTACGACACACTCAATT
>probe:Drosophila_2:1632391_at:150:429; Interrogation_Position=3452; Antisense; GAGTTGCACACATGTATACACCACT
>probe:Drosophila_2:1632391_at:290:219; Interrogation_Position=3559; Antisense; AAGTCTTGAGACGACGGGCTGCCAA
>probe:Drosophila_2:1632391_at:663:407; Interrogation_Position=3571; Antisense; GACGGGCTGCCAAAGATTAAACAAC

Paste this into a BLAST search page for me
ACATTGCCGGGCAGGAACTTCCATGAGGAACTTCCATGTCGAATCGGTTGCGAATCGGTTGGTTTCCAAGTCGCATACAACTCGAGTTTCCTGTTAAGTTTAGTTTCTAGGAATGGCTGCCGTCCCTGCCGTCCGCAATTGTTGATTTATTTTGTTCTCAAACTCAAGTGCTTATAGTGCTTATACTTTGATTCCTATTATATTAGTTGTTCACTCTATCCTCCTATCCTCCTGTCGTTCTAATGTTCAAGACGTTTTGTACGACACACTCAATTGAGTTGCACACATGTATACACCACTAAGTCTTGAGACGACGGGCTGCCAAGACGGGCTGCCAAAGATTAAACAAC

Full Affymetrix probeset data:

Annotations for 1632391_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime