FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632393_at:

>probe:Drosophila_2:1632393_at:472:177; Interrogation_Position=1047; Antisense; AAACGATTGGATAGCTCCGCCGGAA
>probe:Drosophila_2:1632393_at:260:557; Interrogation_Position=1077; Antisense; GGACATGCTTTTCAACAGGTTGCCC
>probe:Drosophila_2:1632393_at:27:699; Interrogation_Position=1138; Antisense; TTTAACCACTTCGATCTGGTCTGGG
>probe:Drosophila_2:1632393_at:7:617; Interrogation_Position=1208; Antisense; TGCAATCAGTTGTTCCATACTCCTC
>probe:Drosophila_2:1632393_at:354:29; Interrogation_Position=1224; Antisense; ATACTCCTCCTACAATGATGGCGAT
>probe:Drosophila_2:1632393_at:466:205; Interrogation_Position=699; Antisense; AAGCGCGGCTGGCTACAATGAGTTC
>probe:Drosophila_2:1632393_at:303:93; Interrogation_Position=719; Antisense; AGTTCCTGCCCAGCAACAGTGTGAT
>probe:Drosophila_2:1632393_at:189:205; Interrogation_Position=754; Antisense; AAGCGTTATGCCTGCCGGGATATCA
>probe:Drosophila_2:1632393_at:314:693; Interrogation_Position=779; Antisense; TTTCCAGCAGTGTCTGTCAGAGTCT
>probe:Drosophila_2:1632393_at:211:101; Interrogation_Position=797; Antisense; AGAGTCTCTTCTTTATTCTTTTCGG
>probe:Drosophila_2:1632393_at:255:13; Interrogation_Position=811; Antisense; ATTCTTTTCGGTTTCAATGGCCAGC
>probe:Drosophila_2:1632393_at:658:85; Interrogation_Position=837; Antisense; AGTGAACCAAACGATGTTGCCGATC
>probe:Drosophila_2:1632393_at:512:469; Interrogation_Position=852; Antisense; GTTGCCGATCGTAGTGGGTCACACT
>probe:Drosophila_2:1632393_at:254:671; Interrogation_Position=952; Antisense; TACGGACTGTTGAACTTCCTGCATT

Paste this into a BLAST search page for me
AAACGATTGGATAGCTCCGCCGGAAGGACATGCTTTTCAACAGGTTGCCCTTTAACCACTTCGATCTGGTCTGGGTGCAATCAGTTGTTCCATACTCCTCATACTCCTCCTACAATGATGGCGATAAGCGCGGCTGGCTACAATGAGTTCAGTTCCTGCCCAGCAACAGTGTGATAAGCGTTATGCCTGCCGGGATATCATTTCCAGCAGTGTCTGTCAGAGTCTAGAGTCTCTTCTTTATTCTTTTCGGATTCTTTTCGGTTTCAATGGCCAGCAGTGAACCAAACGATGTTGCCGATCGTTGCCGATCGTAGTGGGTCACACTTACGGACTGTTGAACTTCCTGCATT

Full Affymetrix probeset data:

Annotations for 1632393_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720