Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632396_at:

>probe:Drosophila_2:1632396_at:604:161; Interrogation_Position=304; Antisense; AAATTGGCCGAACTGGTGCCAGCTG
>probe:Drosophila_2:1632396_at:79:667; Interrogation_Position=337; Antisense; TACAGATACTCCGATCACTGGACCT
>probe:Drosophila_2:1632396_at:678:585; Interrogation_Position=355; Antisense; TGGACCTTCATTACGCAGCGTTTGA
>probe:Drosophila_2:1632396_at:62:453; Interrogation_Position=378; Antisense; GATCTTCATCATTGCCTTGGTTATT
>probe:Drosophila_2:1632396_at:142:89; Interrogation_Position=470; Antisense; AGTCTGAGGGCTTCCATCTGGATGT
>probe:Drosophila_2:1632396_at:216:75; Interrogation_Position=497; Antisense; AGGACTATCTACTGGGCATACTGCA
>probe:Drosophila_2:1632396_at:456:271; Interrogation_Position=513; Antisense; CATACTGCAGTTGGCGTCGGAGCTC
>probe:Drosophila_2:1632396_at:410:365; Interrogation_Position=588; Antisense; GAATATCTCCCATTTTATTGGTGAC
>probe:Drosophila_2:1632396_at:543:689; Interrogation_Position=603; Antisense; TATTGGTGACCTGAACACGGGCTTC
>probe:Drosophila_2:1632396_at:570:341; Interrogation_Position=623; Antisense; GCTTCCGTCTGCTGAACCTGAAGAA
>probe:Drosophila_2:1632396_at:381:391; Interrogation_Position=659; Antisense; GAAAGCGCTTCGATGCCTTAAAGTA
>probe:Drosophila_2:1632396_at:410:643; Interrogation_Position=710; Antisense; TCTACGATGTCAGCATACGCGGTCT
>probe:Drosophila_2:1632396_at:562:27; Interrogation_Position=724; Antisense; ATACGCGGTCTGTCCAGCAAGGAAA
>probe:Drosophila_2:1632396_at:590:573; Interrogation_Position=768; Antisense; GGCTGTTCCTGCAACCGAATAGTTT

Paste this into a BLAST search page for me
AAATTGGCCGAACTGGTGCCAGCTGTACAGATACTCCGATCACTGGACCTTGGACCTTCATTACGCAGCGTTTGAGATCTTCATCATTGCCTTGGTTATTAGTCTGAGGGCTTCCATCTGGATGTAGGACTATCTACTGGGCATACTGCACATACTGCAGTTGGCGTCGGAGCTCGAATATCTCCCATTTTATTGGTGACTATTGGTGACCTGAACACGGGCTTCGCTTCCGTCTGCTGAACCTGAAGAAGAAAGCGCTTCGATGCCTTAAAGTATCTACGATGTCAGCATACGCGGTCTATACGCGGTCTGTCCAGCAAGGAAAGGCTGTTCCTGCAACCGAATAGTTT

Full Affymetrix probeset data:

Annotations for 1632396_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime