Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632397_at:

>probe:Drosophila_2:1632397_at:34:29; Interrogation_Position=4580; Antisense; ATAAGACCCGGCCACACTATATCCT
>probe:Drosophila_2:1632397_at:171:147; Interrogation_Position=4595; Antisense; ACTATATCCTGGCACCAGTGACGGT
>probe:Drosophila_2:1632397_at:457:267; Interrogation_Position=4610; Antisense; CAGTGACGGTGCACCGGCACATGGA
>probe:Drosophila_2:1632397_at:134:391; Interrogation_Position=4633; Antisense; GAAACTGCCGAATCGTAGTCCACAA
>probe:Drosophila_2:1632397_at:6:659; Interrogation_Position=4681; Antisense; TAAGATGTCCGCTTGTTTGCCAATT
>probe:Drosophila_2:1632397_at:81:195; Interrogation_Position=4737; Antisense; AACTGCCGACAGTCCAGAATGCTGG
>probe:Drosophila_2:1632397_at:547:201; Interrogation_Position=4774; Antisense; AACCCGCAATGTGTTTTGTGAGCTC
>probe:Drosophila_2:1632397_at:411:5; Interrogation_Position=4811; Antisense; ATTGTTGGCCCATCTGTATCTATTA
>probe:Drosophila_2:1632397_at:165:483; Interrogation_Position=4826; Antisense; GTATCTATTAGAGCCTCCGTGGACG
>probe:Drosophila_2:1632397_at:449:553; Interrogation_Position=4846; Antisense; GGACGAGACGAACACCAACTATTAA
>probe:Drosophila_2:1632397_at:629:401; Interrogation_Position=4876; Antisense; GACATTGTTTCTGCCATTTTTGATC
>probe:Drosophila_2:1632397_at:72:511; Interrogation_Position=4967; Antisense; GTGCAGCTATATACTTCCGATATTT
>probe:Drosophila_2:1632397_at:431:685; Interrogation_Position=5061; Antisense; TATATCGTTTTTTGTAATAGCCCCT
>probe:Drosophila_2:1632397_at:593:491; Interrogation_Position=5074; Antisense; GTAATAGCCCCTAAGACTACAGAGT

Paste this into a BLAST search page for me
ATAAGACCCGGCCACACTATATCCTACTATATCCTGGCACCAGTGACGGTCAGTGACGGTGCACCGGCACATGGAGAAACTGCCGAATCGTAGTCCACAATAAGATGTCCGCTTGTTTGCCAATTAACTGCCGACAGTCCAGAATGCTGGAACCCGCAATGTGTTTTGTGAGCTCATTGTTGGCCCATCTGTATCTATTAGTATCTATTAGAGCCTCCGTGGACGGGACGAGACGAACACCAACTATTAAGACATTGTTTCTGCCATTTTTGATCGTGCAGCTATATACTTCCGATATTTTATATCGTTTTTTGTAATAGCCCCTGTAATAGCCCCTAAGACTACAGAGT

Full Affymetrix probeset data:

Annotations for 1632397_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime