Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632398_a_at:

>probe:Drosophila_2:1632398_a_at:619:701; Interrogation_Position=1141; Antisense; TTTTCTTCAGGAGAGCGGAGCATCT
>probe:Drosophila_2:1632398_a_at:190:513; Interrogation_Position=1171; Antisense; GTGATTTCTACGTTAGCAAAGCCGA
>probe:Drosophila_2:1632398_a_at:391:325; Interrogation_Position=1186; Antisense; GCAAAGCCGAAGATTCCTACCATGT
>probe:Drosophila_2:1632398_a_at:444:463; Interrogation_Position=1197; Antisense; GATTCCTACCATGTCTTAAGCTTAA
>probe:Drosophila_2:1632398_a_at:699:709; Interrogation_Position=1212; Antisense; TTAAGCTTAAGCTCCTCCACATAAA
>probe:Drosophila_2:1632398_a_at:45:689; Interrogation_Position=706; Antisense; TATTCAGATTTCACAATGGCCGGGT
>probe:Drosophila_2:1632398_a_at:514:303; Interrogation_Position=725; Antisense; CCGGGTGTTATCGATGGTAGCCAAC
>probe:Drosophila_2:1632398_a_at:459:241; Interrogation_Position=769; Antisense; AATATCGCAGGCACTTTAGGGACGC
>probe:Drosophila_2:1632398_a_at:352:705; Interrogation_Position=784; Antisense; TTAGGGACGCCAGATTCGTTACCCA
>probe:Drosophila_2:1632398_a_at:484:95; Interrogation_Position=795; Antisense; AGATTCGTTACCCATATTCCCTATT
>probe:Drosophila_2:1632398_a_at:530:555; Interrogation_Position=822; Antisense; GGACCCAACTTCGATGGACTATGTT
>probe:Drosophila_2:1632398_a_at:346:487; Interrogation_Position=882; Antisense; GTACCTACAGATTTGCGTTACTCGG
>probe:Drosophila_2:1632398_a_at:60:431; Interrogation_Position=927; Antisense; GAGTCCCAACTACACGAGCATTTAA
>probe:Drosophila_2:1632398_a_at:678:421; Interrogation_Position=952; Antisense; GAGAAACCCATCTGCGATTTGATTT

Paste this into a BLAST search page for me
TTTTCTTCAGGAGAGCGGAGCATCTGTGATTTCTACGTTAGCAAAGCCGAGCAAAGCCGAAGATTCCTACCATGTGATTCCTACCATGTCTTAAGCTTAATTAAGCTTAAGCTCCTCCACATAAATATTCAGATTTCACAATGGCCGGGTCCGGGTGTTATCGATGGTAGCCAACAATATCGCAGGCACTTTAGGGACGCTTAGGGACGCCAGATTCGTTACCCAAGATTCGTTACCCATATTCCCTATTGGACCCAACTTCGATGGACTATGTTGTACCTACAGATTTGCGTTACTCGGGAGTCCCAACTACACGAGCATTTAAGAGAAACCCATCTGCGATTTGATTT

Full Affymetrix probeset data:

Annotations for 1632398_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime