FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632399_at:

>probe:Drosophila_2:1632399_at:237:171; Interrogation_Position=101; Antisense; AAAGTGATTCTCCACAGCGTTCAAT
>probe:Drosophila_2:1632399_at:284:661; Interrogation_Position=125; Antisense; TAACTCTATCCCAAATACGTGCTGC
>probe:Drosophila_2:1632399_at:95:29; Interrogation_Position=139; Antisense; ATACGTGCTGCCTACAGTCAACGAA
>probe:Drosophila_2:1632399_at:686:83; Interrogation_Position=154; Antisense; AGTCAACGAACTGGCCAGGACTTTC
>probe:Drosophila_2:1632399_at:49:269; Interrogation_Position=169; Antisense; CAGGACTTTCCCGTCAAGGGTGGCA
>probe:Drosophila_2:1632399_at:228:521; Interrogation_Position=188; Antisense; GTGGCACGCGAACCCAAATGTGTTT
>probe:Drosophila_2:1632399_at:548:165; Interrogation_Position=203; Antisense; AAATGTGTTTCGTCCTGACAATCCC
>probe:Drosophila_2:1632399_at:78:613; Interrogation_Position=218; Antisense; TGACAATCCCTTATGTTGCCTGCTT
>probe:Drosophila_2:1632399_at:306:721; Interrogation_Position=233; Antisense; TTGCCTGCTTCACCAGTCAAATTGG
>probe:Drosophila_2:1632399_at:533:725; Interrogation_Position=254; Antisense; TTGGCACATTGCGATTCTTCACCAT
>probe:Drosophila_2:1632399_at:486:713; Interrogation_Position=268; Antisense; TTCTTCACCATCGAACTGAACCAGG
>probe:Drosophila_2:1632399_at:443:191; Interrogation_Position=28; Antisense; AACTTTTTCTATAAGGTGCAGCGGA
>probe:Drosophila_2:1632399_at:340:561; Interrogation_Position=50; Antisense; GGAAACATCCCACCATTCTGGACGA
>probe:Drosophila_2:1632399_at:266:553; Interrogation_Position=69; Antisense; GGACGACTTGCGAGCAGTTTTCAAA

Paste this into a BLAST search page for me
AAAGTGATTCTCCACAGCGTTCAATTAACTCTATCCCAAATACGTGCTGCATACGTGCTGCCTACAGTCAACGAAAGTCAACGAACTGGCCAGGACTTTCCAGGACTTTCCCGTCAAGGGTGGCAGTGGCACGCGAACCCAAATGTGTTTAAATGTGTTTCGTCCTGACAATCCCTGACAATCCCTTATGTTGCCTGCTTTTGCCTGCTTCACCAGTCAAATTGGTTGGCACATTGCGATTCTTCACCATTTCTTCACCATCGAACTGAACCAGGAACTTTTTCTATAAGGTGCAGCGGAGGAAACATCCCACCATTCTGGACGAGGACGACTTGCGAGCAGTTTTCAAA

Full Affymetrix probeset data:

Annotations for 1632399_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720