FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632400_at:

>probe:Drosophila_2:1632400_at:48:21; Interrogation_Position=1214; Antisense; ATATTGGGCATGGTGTCCATCGTCT
>probe:Drosophila_2:1632400_at:153:37; Interrogation_Position=1232; Antisense; ATCGTCTGGTCCAACTAGCTAGTCA
>probe:Drosophila_2:1632400_at:698:673; Interrogation_Position=1247; Antisense; TAGCTAGTCACTTTACCCCAGTTTA
>probe:Drosophila_2:1632400_at:58:141; Interrogation_Position=1289; Antisense; ACGTGGGTGATCAAAGTCTCTCAGC
>probe:Drosophila_2:1632400_at:327:499; Interrogation_Position=1304; Antisense; GTCTCTCAGCTCCTTTGAATGGTGA
>probe:Drosophila_2:1632400_at:310:595; Interrogation_Position=1346; Antisense; TGGGCCATGCGGATGATCTGCACTA
>probe:Drosophila_2:1632400_at:617:39; Interrogation_Position=1361; Antisense; ATCTGCACTATGTGTTGCCGGGTTA
>probe:Drosophila_2:1632400_at:213:537; Interrogation_Position=1388; Antisense; GGTATGGTCCCTTAATGGCGGCAAA
>probe:Drosophila_2:1632400_at:284:439; Interrogation_Position=1431; Antisense; GATGGAACGTTTAACCAGCTGGTTT
>probe:Drosophila_2:1632400_at:711:587; Interrogation_Position=1450; Antisense; TGGTTTACCCACTTTGCCAAAACAG
>probe:Drosophila_2:1632400_at:560:391; Interrogation_Position=1476; Antisense; GACACCCCTAAACAGCACGGATATT
>probe:Drosophila_2:1632400_at:312:635; Interrogation_Position=1564; Antisense; TCGCCCGGCTATTCGAATCGATATG
>probe:Drosophila_2:1632400_at:411:49; Interrogation_Position=1586; Antisense; ATGCCGTCTGGGACAAACTGTTTCC
>probe:Drosophila_2:1632400_at:486:439; Interrogation_Position=1628; Antisense; GAGGCGCTGCCTTGAAACTCAGTTT

Paste this into a BLAST search page for me
ATATTGGGCATGGTGTCCATCGTCTATCGTCTGGTCCAACTAGCTAGTCATAGCTAGTCACTTTACCCCAGTTTAACGTGGGTGATCAAAGTCTCTCAGCGTCTCTCAGCTCCTTTGAATGGTGATGGGCCATGCGGATGATCTGCACTAATCTGCACTATGTGTTGCCGGGTTAGGTATGGTCCCTTAATGGCGGCAAAGATGGAACGTTTAACCAGCTGGTTTTGGTTTACCCACTTTGCCAAAACAGGACACCCCTAAACAGCACGGATATTTCGCCCGGCTATTCGAATCGATATGATGCCGTCTGGGACAAACTGTTTCCGAGGCGCTGCCTTGAAACTCAGTTT

Full Affymetrix probeset data:

Annotations for 1632400_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720