FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1632401_at:

>probe:Drosophila_2:1632401_at:581:485; Interrogation_Position=2031; Antisense; GTAGAAACTTGCCAAACGCCCAAAT
>probe:Drosophila_2:1632401_at:153:273; Interrogation_Position=2135; Antisense; CATTGTTGTTGCTTCATTTTGCCGC
>probe:Drosophila_2:1632401_at:134:17; Interrogation_Position=2150; Antisense; ATTTTGCCGCAAATGCTGGGAAATC
>probe:Drosophila_2:1632401_at:566:703; Interrogation_Position=2178; Antisense; TTGGAAAATAGGTGTGCCCGCCGCC
>probe:Drosophila_2:1632401_at:61:487; Interrogation_Position=2191; Antisense; GTGCCCGCCGCCATAAAAGCGAAAA
>probe:Drosophila_2:1632401_at:693:467; Interrogation_Position=2334; Antisense; GTTGCTCCCAGGTACTTTGGACCAG
>probe:Drosophila_2:1632401_at:153:691; Interrogation_Position=2349; Antisense; TTTGGACCAGTGTTTACGACCTTCT
>probe:Drosophila_2:1632401_at:190:477; Interrogation_Position=2360; Antisense; GTTTACGACCTTCTTTGGCACTGAA
>probe:Drosophila_2:1632401_at:575:567; Interrogation_Position=2376; Antisense; GGCACTGAAGCATACCATTATATAC
>probe:Drosophila_2:1632401_at:394:129; Interrogation_Position=2389; Antisense; ACCATTATATACCATCCCAGACTTT
>probe:Drosophila_2:1632401_at:494:237; Interrogation_Position=2447; Antisense; CATGCTAAACCTTTAATTCCAACGT
>probe:Drosophila_2:1632401_at:420:9; Interrogation_Position=2462; Antisense; ATTCCAACGTACTTATGTATCATTG
>probe:Drosophila_2:1632401_at:248:611; Interrogation_Position=2485; Antisense; TGAAAACGCGAATTCTTTAGTACTT
>probe:Drosophila_2:1632401_at:588:61; Interrogation_Position=2526; Antisense; ATGTCTTAACCTTCATCTGTTGCAG

Paste this into a BLAST search page for me
GTAGAAACTTGCCAAACGCCCAAATCATTGTTGTTGCTTCATTTTGCCGCATTTTGCCGCAAATGCTGGGAAATCTTGGAAAATAGGTGTGCCCGCCGCCGTGCCCGCCGCCATAAAAGCGAAAAGTTGCTCCCAGGTACTTTGGACCAGTTTGGACCAGTGTTTACGACCTTCTGTTTACGACCTTCTTTGGCACTGAAGGCACTGAAGCATACCATTATATACACCATTATATACCATCCCAGACTTTCATGCTAAACCTTTAATTCCAACGTATTCCAACGTACTTATGTATCATTGTGAAAACGCGAATTCTTTAGTACTTATGTCTTAACCTTCATCTGTTGCAG

Full Affymetrix probeset data:

Annotations for 1632401_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720